Description :
From Genome Similarity Track
Location :
scaffold_385:23016- 24056
Transcript NameFunction/comments
Pl_105369hypothetical protein PHYSODRAFT_530679

Sequence
1040 bases(100 bases per row)
TGTCGAGTGCGTTGAAGCCGCAATTCGTTCTCTTTCTCTTGAATATCGATGTGTGCTTTCTCTAGAAGTCGCTCCAGCCGTGAAAGTTCGTGTGAGTAGT
TGTCCAATTGGTGTGCATGGCGCTGTTGTGAAGTTTTTCTGTCCTCTTCTGCTTTATCCAGCTTGACCATGTAAACTTCTAACATATTTGCTTCATGAGA
CTGAGATCTACGACATGAGCAGCCTTGAGCTTCTGCTGTTTGTGCTCGAGGACTTTTCCTTGGACTCAAGTTGGACGGTGATACTGGCGGCCGTCGAAAC
GGTGAGACTGCAGGACGAGGTGTGATTGTTCTCAACTTGTCATCTTTCTCGTCTCTAGGACTGGAAGGTTGATGCGGTGGTCGTGGCACTGCAGGTAGCG
ACGTGTCATGGCTCTTTACCCCACCAAGTGTAGTCGTATGCAGCGCCCGAAGAGTTTGTTTGTGCAATTGCACCTCAGTGCGTAAACTGTCGATCAACTG
CAAATACTGCTTTTTCTCATCAGTCATACTAGCAACCAGTTTGTTTTGCTGCTCTAGCTGATGGCTTAGGCGTTTGTTGACAGCCCGCAGACGAGAAATG
ACTGTGTACGTATGTTGGTCGTAGTAAAATTGTGTTTGCCGCTCTCGTTCTCTCTTGAGCACCTTGGTTCCTACGTGTGCTTTCAAAGTTGAGGGATACT
CGTTAATGAAATCGTCCTGTGTTTGCTCTTGCTCCACCTTGTCCACATTTCCCAGCTCGCTGATACATGTATCTGTGGTATCCGCCTCACATTCACTTTC
ATTGTCGTATCCATTTTCAGCAGTACCATCCGGTACCAATTCAAACACGTTAAATGACATCCCACCACCATCTTCTTCAGGGTCGTCAAATTCAAAGGAG
TCGGCAAACGATTCAGTATTCTCTTCTCTCACTGAATGACATTCACTGGGGTAGCTTGATTGTTTCTTACTTCCACCGATAGCTAAACGTGATCCAACTG
ATATCGAAGTCAGTGGTGTGCTAAGCACGTTCTGTGCTTG