Description :
From Genome Similarity Track
Location :
Scaffold_15:230111- 239149
Transcript NameFunction/comments
g3135.t1RAW36312.1 hypothetical protein PC110_g7435 [Phytophthora cactorum

Sequence
9038 bases(100 bases per row)
CTTCACTCGGCACCGGGACGAAGCACCTTCGTAGGACGAGCTGCTGCCGACGCGGAGCCCTTGAGCACGGTGTGTTTGCGCTTGCGCAACTGCTTGGTAC
GACGCTTTTGCTCGTTCTTCTGCATCCGGCGCTGGGCTGCCCGCTGCGGGTCGGCCACTGCTTCGGTGCGGCGCTGAAGTTTCCGTGCGGCGCGACGCGA
CGCCATCTTCCTCTGCACGAACGAGTAGGCCTCCAAGAACGTCGCCGCTCCCAGCTTTTTCTCCAGAAGCTGCAGCACTTCCTGCGCAAGTAGTGCGCTC
TCAGGTGGTGCCACGGACTCCGGTGCAGGACCGCTCCTTCGGTTCTTGTAGCGGTTGCGCTGTTGTTGCTGCAACCGCACCTGCTCCTGCTGAGCCTGCA
GCTCTTCCAGCTTGCTTGAAGCTCGATACAGCGGATTGATGATCTGAACAACATACTGCTCGGCGAAGGCCGCGTCGTGGCTGTGCAGCAGAGCGGCGAA
CAGCTTGAACACCACGGCTTGCACCTCGTTGCTGCAGCTTGAGCCGCGTGCAACGTACGAGAGCCGCGTAAGCAGCCAGCCCATGGGTGTACTTGCCTTT
GCGCGCTCCTCGGTCTTCTCCTGCTCCTCACGACGCTGCAGTTCCGCCTCGTCCTCGTCAGCCTTCTTCTCATCAGTGGCAGTGTCCTCCTCATCCCCAC
CCGCATCCTCAGCTTCAACTTCAACGCTTGTGGCATTCGCCTCGCCATCCTTCACGGAGTCAGCAGCGGCAGCCGTCACGTCCTGCGGGATATCGGTTGT
CTCAAGCGCTTGGCACAGGAACGGCAGCGCTGTAAGAACCTCGCTAGTTAGCTCGCTGTTCAGTGCCGGTGCCTCCAGCAGCTTGCAGAAAGCACTAGCC
CAGATGAACAGACGGCCAGGACGCTGCAGATACAGCGCTCCATTCTGCAGACGCTCCAGGGCATCTCCAGATAAACGCTTCACCGGAGCTGCAAAGGCAA
GCGTGCTCGCTTGGCGGCGGCTCAGATACGACGTCAACAATCGGGTTGCGCCAAGACGCACCCAGGCGTGGGGGTACTGAAGCAACGGCAGCACCACCGC
GTCCAGGAAATTCGTCGACACCTTCAACTCCTCCAGCCAAAGCTCGTAGGGACCAGCAAGATGGTCGCTGAAGGCTCTAAGCGCGACACAAACATGGTAT
GTCGGCTGCCACCGCACCTGATCACTGTCCTCCACAGTCTGAAGCTCATGTAGACTGCGCTCGAGCGCTGTGCGCGTCGCAGCCAATACCTGAGGCGCGC
TGCGCTCCATGAATTCGGGTCGGGTTTCCAGCACAAGCGTCGTCACCTGAGCTGCAGCCCCGAGTAGCTTCACCGCATCCGCAGTATTCGAGTTTGCTGC
TTGTGTCCACCACGTGCACACCAGCAGAATGCTCTCGTTCAGCTCCTTGTTGCCAAGACGACGCACAAGCGTGCTCAAAGCTGCCCGAGCCAGGTCACGG
CACTCCGAAGCCTCGTCGTTTGCTAACCGTAACACCAGCGGCAAGAAGAAGAACTGGGACCGAGCGTTCACCAAATCCTGCGGGAGCTTCGTGAGAAGCG
AACGAAGAGCCTCAAGTACGGCAGCGCGTCCAGTAGCGTGTCCGTAGCTCAGGTTGTCCACCAAGAATTTGAGGTGACGAGACAACCGCTTGTTTCCAAG
AGGGTACTCAAGCAGGAATGTCTGGTAGATGGTTGCACAGTTTAGGCGCGCACCCGGGGCATCGCTCTGAACAAGTAGCTCGCCAACACGCAGCATCACG
TCGTACACCTCGCTCACCACCAGATGAGAGTTCACAATGGCCTTCAGAAGGGCGAATGTGGCGTTCTGGTGATCTTGCTCGTCAAGATCGGCTCGCAAGA
AACTCAGAAGCACGCGAAGTTGCGGTTCCGTCAGACGCAACGCCTCGTTCTTCGAGTCCTTGGGCGCGTTGCCGTTCTCCTGTGCGAGTTCCAATCCTTG
CTGTTGTCTAAGGAGCGCAGTAAGGGTGCGGTAGCATGTCTGCACCATCTCGTTGCGAGTAGCAGCTCCAGCCTGCTGCAGAATCTTAAAGAGGCGGTCA
AGAAGAGGTGTGCGCGCCACCCGCAAAGCAGGGAGCTCTTCCTGTCGAGGGAGCATTGAGCCAACGCACTTGAGCGCGTTGATAACAGCTCGGTCGTTCT
TTGACTCGCCAGCGCAACGCATCAGCAGAGGCACAAGCGGGTCGACGAGCTGGGCCGGAGCGTCTGAAATCTTCTCTGCGTCTTGGTTCTTGGAGCTGCC
ACTCTTGCGGAGGAAGGTGAATACCAAGAAGACACCAAAGTTTAGAAGCTCTCTCAGATGAGCGGTGCTCTCGGCTAGCAGAGCAGCAATCGCCTCGCGC
TTTTGCTTTTTGGTCTTGCTTTGCTGTTGCTGGCGCAGTTTATCAAACCCAGTGACCTGTTGCTGCATCGCAACACGTACAGTGTCCCGGGCTTTCACTC
GTGCGGCAAGCAGTTTAGTGGCTCGCGCACTCTTCTCGGACACAAGCCACGAAGTCACCAGTGCCGTGCTGCTACCTGCCGCTTCGTATTGCTCCTTTTC
CCTCTCTGAAGTCGGGCGCAAACTCTCCAGGCTCGAGTTGAGCACATTGTACGCGTAGAGGAACATGTAGGACGATTCCACAGAGGGGTTCTTCGCAAGG
CCAATCGCTATGCGCTTCAATGCTTCCTGCAACGCGGCCGTAGCTTGAGCCCCAGCGTCTGTCGCCTGGAAGCGCTTTACAAGAGCACTTACGACCTCGT
GGATGCTTGGATTGGGCAAGAACGGCAATGATCTTGCCAGCAACTCCAGCGAGTCCAGGCTTCGCCCACCGCTCGAGCGGGCCTCCTTCATCTTGGATTT
TTGAGCCGATCTCCGTTCCACGCCTCCAGCAGCAGCCTCCGCGGCCTCGCCGATGGTAGTCATACCCTGGAATAACTCTGCGGCGAGAATCTCCATCAGG
CTTGGCACGCAAGCATCCAGAGGGGATGCAAATTCAGCCTCGCTCTCGGCTTCCTGCTGCTTGTCTTGCATAAGCAGCAATGATTGAGGCTTCCGAGGTG
GGCCGGCGTGTCCTTCACTCTGCATGATCTCGGGGAGCTTTTCCAACAGGGCGTGCACCGTAAAAGACAGCACATGGACCATGTATCCATCGCGCAGAGT
GTGGCGAAGCTCCTCCACAATCGGTAGTAGGAAGCGTGCACCAAGCTCCACAGCGATTCTAACCAGCGTGGTACGAGCTGAAACACGCACAGCTTCATCC
TTATTTTTCAGCAAGTTCGCGAAACGCAACAGCAGCTTGGGTAGCTCACGTTGGAAGGTCTCAGCCCGCAATCGCCGCAGCACCTTCACGACAGCCAGCG
CGAGAGGCACACGGACAGAAACAGACTCCTCGGAGAGCGAAGATGGCTCGCTATCGTTCTCTTGCTTCTTCGAGCTCTTTTTCGAGCCCGCACTCTTGAA
CAGATATGAGTAGAGCATCGGAAGAACTTGTGTCTCCATGTTATCCTGCACCTTGGAGGATCCGTCTTCATCTTTCTGCTCAGGCTCGGAGGGGTTGCTG
TCAGTGTTCACCTTACTGGACGACAATTGCCACTGAGTAGCCGCACCCGGCGCCTCGAAGTGAAAGTGGTCAATCACTGCGCAAATGGACATAATGATAG
CGCCTTCCATTTCAACATGACCGTCGATCGACTTCAGCAGTCTGCGAAGCAGTGACAGGTAGTGCGACCAGCTCAACAGGCCAGCAGCACTGCCTACGCA
CGCTGCAGCTTCAGCGCGCAGAGACTCCTGGCTCTTTGCGTGTGTCTCGTAGACAAAGTGCAGCACCAGAGGGAGGATGACACCATTCACCGTCGAGTTC
GAAAAGCACACAGGTTCTCCAATTTCCTCACCATCAACTTGACCCTGGGCCTTACCAGCCATGGAGTCCATGAGAGCGCTGAGACGCTGAAGGGCACGAC
GTCTGCGGTGAGCTTGAATGTGCGTAATGTTGTAGAAAAAGTCAGCCTCTGGGTCCTCGTGGTTGCGCGCCAGCACCAGATCTGCTGGAATAAATGCAAA
CTGTCTAAATGCCTTGTGTTGGTCCGCCAACGATCCCAACAGAGTCACAAAGCCTCGCCGCGCATTCTCATCAGTCGAGCGCAGACTTGCCCGCACGCAA
GGCATCACCAGCGACTCCAATCCATTAAGCACAGGAGACTTCGCGGCATCGTCTTGCCTGCTCTGCTCGACTGCAATCTCTGCTGCTAGTCCCAGGAACA
CCGTAAGGCTGGCAAGCGCAGCGCTGCGCACTGAGAATTCAGCGTTGTGCATGGACTGCAGGCACTGCGCCACCAGAGGAGCTAGCAAATGAGTCTCGTG
CGTAAACCCGTCAAATCGTGTGGTGTTAAGGCGGTTTAGCGCAATCAAGCGACGCTCGTAGTCGGTCTCCTCGATTTGCTTAGCGTCGTATGCGTTGAGC
TCATCCAGCAACTCTGCCACGGGCGCCAGCTCTGTAAGCGCAGGATGCGCGCCCAGAGCTGTAAATACCATTACTAGTTTCAGGCGGGTATCACGATCGG
CAATGCAATTCGGACCTGGAGCCAGCAGCCGTGCAAGGGCGAGCACATGCTTCTTAGGCTCCGAGAGCTTCGGCACCAAGTGGGCCAGCACCTCCAATAG
GTTTTCCTTGTCCTTAGGCGACGTCTGGTGGTTGCGCAGCAAGAATGGCAATAGCAGCTGAAACAGATCGTGGGCAGCAATTGCCACGTCTCCGTCAGAG
GCGTCTAGATGGTGCGACAGCCGGCAGAGGAACGTAAGCTCCTTTCGAGATGATCCAGCGTACCGGTCGCTTGCGTAGCGTGCAGCCTTGGCCTGGAACC
GCTGCACAAATTGCTCCAACACGAAAGGGATGTGGCTCACTAGCAGCACCTTGTCATCCTCCTTGATGGCAGTCATAGCCTCGTCTTCGGCCAACACACT
TTCATCTCCATCCAGCAATGAATCCATAAACTGCAGGATAGAGTCTAGAATTTCAGGCGAAATGCCACGACTAGATGCGGACGACACGCTCGATGACGTC
AATCCTGCCGACAAGCATGAGATAACGCTTAGCACCAGAGGCTCCGGGATCCACTGACGTGCCCTGTCGGCGCGACCCATTGCGACGAGGAATTCCAAGA
GTGCGGAAGCCTTGCCAGCACCGACAACCGCGTTGGACAAGTGCACAACGGCATCATGCGAAGTTTCCAGCACCGCTTCTACCCAGGGTTGGAGGCGCAC
GAGCGTATCAAACTTCATTAGCAAAACATAACAATGGTTAGTACTTTAATTGAACAGTGGATTTGAGAAACCAAGCGCCGTACCGTGTCGATCAACTCTG
CGAGTCGGCGGTATGTCAGCATGCGGATCTGCTTCTTCATCGAAGCAGATGTCACTAGGCTGTCAACAGTCGACGAGGGCTCACCAGCTTTCCGCTTCGT
GCCCACAGCAGCCCCTGCGTCCTCCTTGTCATCATTATTTTCGCCAGTAGTAGCAATTTCATCGTCATCTTCGCCGGAAGCTATACTGATCTGAAGAATA
GCCAGCAACACGTCTGCAAGGCGAGGCGCAAAAGCGGCCAGCTTCACGCCAAGTTGGTTGATAAGGTCCTCGAGCAAATTCAAGAAACCAAGAATGCGCG
AAGGCTGTACATTGGAGACTGCTACGACAGGTTTCACGTTGTCAGAGATAATAACAGTGTCTTGAGCAAGACTCTCCGGGGCTTCAATCGATACATCAAA
CGCACGGACCACAAGTTCCACGAAGCTCGCTAGCTCGGGCGCCTCCAGCGCTGCCAAATATGCTAAGATGGCTACACGGCGCGCAGCCACCGTGTCACCA
TTGTTACGGCCCTTCTTGCTCACGCATTTCGAGTACAAAACGCGCAGCAGAACAGGGAGCAACTCAGGTCGGTGCTCGCGAAGCACAACCCCCTCTCCGT
CGCCCACCTTAAAGCTCGCCAGTTCTTCGCGGAACGACGAAGAATCCGTCAGCCGATTCAACTGCGTCTTGTAGGACACAACTGCCTTGTTGCCAAACGC
GTAGATGCACTGCAAAGCAAGCTTCGAAACCACTTCGTCCGACTTCATCAACAGGTCGAAGAAAAGAGCATGCAGCAACTGCTGCCCGTATGCACCTTTC
ATATTGTGAAAGACAGCAAACAGCTTCAGCTGATCAACAAACTTGCAACGCACTTCCTTGGTGGTCAAACCTTGGAACTCAACTGGCTTACGCCAGTTTG
GAGATGCAGCATCATTCGAACTGTTGGTTGTTTCTTCGAGCTTGACAAGCACCTGGTCAATTTCCTCGAGACGGTTGGCGTCCAGCTCATCCGTGTAGAT
GGCGCTATACTGGTCGCGCAAAAATGTAAGGAAAAGCGGTACCATAAACTTGGTTTTGGCCTCCACAAGGTCCGCGAACTTCATAAGTCCCTTCCACATC
AGCGAATGATGAGTAGGAGCATCTGTGACACTAGATGCATGCACCTTGCCCTGCTCCAGCATGCACACGCGCTCAAACTCCTGAGCAACGCTACTTTCGA
TACCAGACGTGCTCGATTCACTACCGTTCGGGTCCTCGTGGCAAAGTGAAGCGGCAAGAAGCTCTGCACTGATGCATGGCCAAAATTCGTTGAAATGCAG
CCGTGCTGCCGTCTCCACTGCATCCGCGATGTGTGGCCAAATCATAGAGAACTTGACGTGGTACAGACCCAACAATTGGTTCAAGGCAATTTTCTTGTAC
AGCTCCGGGGTCTGTGGCGAACGACACAGGATCTTCACTCGGGTCAGCAGGCGCACCACTTCTCGCTCAGTAGCCACACTGATACTTTTGCATGCGAGCT
CTAGGTTGACGCAGATATCCGGGAGATCGCATGGGCCGCTCAGTGAACCGCTGTCGGAATCAATAAAACCGAGTCGCTTAAATCGAGCCAAAAACTGCAG
AGCCACTAAGCGTAGCTCATGTGCGGGCGAGCGCAGAGTCGCAAGTAGAGAGTTAGCCAGCGAAAGTAGTGCATCAATCGTTAGAACAGCATGCTGCTTT
TCCTCGGACTCCATTCCAATAAGCATCAATAAAGTCGACAGCGTCTTGAATGACGACTCTTTGCCGCGAATTGCTTGCTCCACATATTTCGTTGTCATCG
CCGCACCCTTGTTCTTCGTCTGGTGTTTGGCGATCTGCTGCAGCTGCCACAACTCATCGCGCAGCAACTGGAGTTCGGTAGCTGATGAGCCCGACGCAGT
TTTCAGTCGTTTGTCAAGCTTTGTGACTAGAGGAGTAGTGAAGCCGATCATTTTGTCGTCATTCAACTGCAAAAGCTCCAACGCCTTGCAAAATTTCCAG
CGCACAGCGATATCATCGGAGTCGTTTTCGCTGTTAAAGATTTTCTTACCCGCATCAAATAGTGCCTTCTCAGCGTTATCATCGATTTCCTGAAACGAAA
GCAACCAGTATTGACTTGAGTTCTTCGAGCGTACAATGTAAGCGCTCTGGCCGTCGTTGATTTCGCCTGCATGGACTGTCACGTAGTCACCAAGTTGACA
CAACAGCACACTGAAAGCACTGACATCAACTTCCACCAGCGTTTTAAGTGCAAACTCCATAGCGTTCGGTAGCAAAAAATCAATGACAAAACCCACGTCG
ACGTGTCTGTTGTGCAGCTCCTGATCAACAAACTCCAACAGCTTTTGACGCCAGTACACTTGCTCGTCCTTCTTCGCTGCTACTGCAAAAATCGCCTTCA
CCTGGGTCGAAATCACATCGTCTTCAGCGGGGAACAGCCGCCACACAGCCTCAAAAGTCTGCATGAGTACGTCCCGCAGGGCATTGCTGCGGGACGTGAG
AACCTTGTTCTCAGGAGAAACCAGCGCTGCACAAACCTTGTGCAGGCTCGGTACGCGCACCTCGTACGCGTTACTAGCGCCCGAAAGCAGACTACCCATT
CGCGAAATCAAGAAGCCAAGCAGAACGCTCAGTACGCGGCTCAAATACAGATCGTCCGCGTCAGTAGGGACATCGTCTTTCTCATGGCGAATATTCGCCA
CCTTGTTCACTACGAGTACCAGGCACTCGAGCATCTCGCCCGAATGGTCGGCATCCGTGTGCTTCATCATTTGCCCACACGTTTGGTATACGACCTCAAA
CACCGCCTCCTGTTGCTCAAGCTGCTCCTGCGACTCCTCTGAATTCTTCGGTCGGAACGCTCCCAGCAAAAACAGCAGCACCTCGCGCATGCGGGAGTGG
AAACCATGGTTCACATTGCGCACGAGCGCGAAGAAGAGCTTGGCCGACCCATCCCTCAAGATATCGTCGTTCCGCCCCGAGCCCTTCACCAGCGCCGTCA
AGTACGCACGCAGGTACTTGCGCATCGCCTTGGGGGACTCGATCCGTCTCAGCAGCACGGCCAGCGTCTGCGCTGCAAAGTTGCGGACAAACTCCTTGGG
GTGGCCGAGCAGCGGGAAGTAGCACTTGTGCACGGCGTCCATGTCGGCTAGCAGTTGAACGCGCAGGTAGCTGAAGAGCATCGTGAGCGTCTTGAACACT
TGTGTGCTGAGCTCCGGGTCCTTTGTGTCGATCACAGCCACCACCAGAGGCAAAACTCCACCAAAGTGCGGGTAAAACTCCTTGCCGAGCTCTCTGGCCA
GCGCCGTCACGAGCTTGAGCACGGGCACGAGCCGCTGACGCTGCACGACCGGGTCCGCATTGTCTTCTCGTGCGTCTTTGAGCTCCTTCTGCAGGCGCTT
GATCACCTTTGAGAGGTGATGCAGCAGTTGAGGAGTGGTGGTCACCAGCGGCTGCAGTGCGCGGAACAGGAACTGGAAGCTGTCGAGCGTCGTGAGCTCC
GCCTGCAGACTCAGTTCCTCCTTGAACGAGAGCACGGAGGCCTCGTCCACGGCGCCCGTGCTCTTGGCATGCAGCGTGAGCTCCGTCTGTAGGTTGCTCA
CGCGCTCCTCCACCTTCTGGAAGCGGTGGCGCCGTTTC