Description :
From Genome Similarity Track
Location :
Scaffold_2224:2301- 3669
Sequence
1368 bases(100 bases per row)
TTGAAATTCGGGTGGAAGAAACGCTGCATCTTTAGCACAATGAATACTCGTTCATCGCTTTGCGGTCGGTATATCGCGAGAAAACCTCGAGTGAAAGGCA
TCATGGAGCAGTGTGTGTATATATTAGAAGCTAGCAAAGTGAGCTCGTCAGGTCTGAACGCCATCCGTTGAGTCTGAGCTGAGAGGTagtcgcgcagctc
ctccgaGCAGTCCAGCACGGTTACACGCAGCTTGTACAGAATCAACAGCACTTTTACTTGATTTGCGCTTAACCTCGACTTCTGACGTTCACCAGTGTAA
TTGGCACCAGGATCGATAGAATCTGAACAAGGTTGAGATAATCTCTCTCCAGGGGAAATCCAGCAGGAAGGCAGGAACGTTTTATACGTGCTTTGTCCGG
TCGTTCCGCATGCCGCGCAACTAAAGGCTCCCAAAGATCAAGAATGTGCTTGATTACACGCGTGAGACTGAGAAAACGATAACCACGGTAATCCAGTAGC
TGATGTGGCGACTTGCTACTCTTTTCAAAGAGACAGAGCTCTTCAAAAAGTGAGCCCATTACTTCAATGTGCTTCGCCATGTATATTGTCTGGATAATAC
GGCGAATCAGATCTGTCATTGCGTCTAAGACTTGGAGGCATCAGCTACCATACTCCATGCAATCTTTGTAGCTGCATTAGCCATGTGAGGGATGCACCAC
TGTCAGTTTAACTTGAGGCCGTCCCGCATCATCCATTTAAGATCGGGTCCGGCGTCCGATGAAGCACCCAACAAGTCTCGGCGTGTCAACACAAAATTCC
GCAAAATATCTGCAATCCAACGCTGAAAAGGTCCACGGGGGCTATTTTCAGGCTCTCCGTAATGAGGTTTAAAGTGGCGTGTTCCAAGAAGAATAGATTT
GAATCGGAAATTCTTATCGATCATGTACAAGCGTATCCCGAGAAATTTCATCGTCTGCACCTTTGAGCTCCAAACGTCGGCAACAACTGCGCATGTAGGA
GCTGAACCAACGCGATTTGGCTGGAACAGCTCCTCCATTACCCGCTTTGTCGACGCGTACAGCTCCACAATCGCGTCAGTGACGATTTTAGCACTGATTG
AAGCCTGCATGGCATCTTTGAAGACGAGCTCACGAATTGAAATTGATTCATCATACTCGCCTAGTCGATAAGAAATGTTGTTGTTAACGATACGTAGTGT
CTCCACTAGGATGTACACTTGAGCTGGATCCTCACGAAACACTTGCGAATTACGGAGTTggtccagctcttcatcgcGAGAGCGTCGTTTTTTCTGAACT
ATTTCGGTCCTCACCGATGTTACGTCGTGAGCTATCCTGAGATACTTGGTTGCCACAGACGTTTTACC