Description :
From Genome Similarity Track
Location :
Scaffold_2153:2301- 3611
Sequence
1310 bases(100 bases per row)
TGGGCTGACGGATAGGTTTCCAAGGGTTGACGGCGGAGGTGGAAAATCGGCCCTGATCACGGCACCCAGGAATCCATTGCGCCCGAGGAATTGGAGTTGG
CGGAAGCCGatccagagctgcagctgactATAAAGAATTACGATGATCTGAAACTCACTGGTTACGCTATCGTCTCTTGCTGCTCCGATCTCCCCCTCGG
AGCTCTCAGCTTCGATATTCCCAAGATCGGGGTCGCTCTGATTCCTTACTGCTTAGCTAGAAACCGCACCTTCGAATTTAGCCGAACTCGTAGCTGAGCT
GGAAACCCCATCTTCACCGCTGTCACTATCCTGATCCGATTGCGACGCGCTCGCTGATATATCCGAGCCAAGATCTTAGCTGGAGACTCATCGAGAGCTT
CGGAGGAATCGACGCTAATCGGCATGTCGGGGCTCCAGCTACTGGATGCTCCAGGCGGAAGGGAACGCCGGCGGAGGGAGGCCCAAGATTGTGCGACTCC
CGCATGAAGAGGCTCGTCGCTATCCGACGCCGAAGCTATAGGCAGAGCAGAGCGAGaaggcgcagctgctcgcccCAGACTCCcgcctcgaagacgccga
gggCTGTCCGCTGGAGAGCGATCTGTCGGTGACTGAATGGCAGTAGCCCCCTGGCGGGGATGAGCGCAAATGTGGTGTGCGCAGCTCATACTCCTGAAAA
AAGTCAAAAGCTGGTGGCGATGTTGAAGAAACAAGAGAGCATAATGATTGCGAGTGGCAACGCTCTTCCGCCGCCAGCCTACGGCGCGGTATGTGATATC
GATGTACAAGGACATCAACCGATTaagcagcgagctcggcggATACCTCTACGACATCTGACGAAGCTCTATGACCTGCTGAAAGGCTTACTGAAAGCAG
GACTGATTGCCTTCTCTAACAGTCCTTGGGCCTCGCCAATCATGATagtgctcaagaagaacggggTTGACATCCGATTATGCATTGACTACAAGATGGT
AAATGCTATCACGGCAATCATGGAGTATGCGATGCCACTAGTTGATGACTTACCCACCGAGCTAGAAAGCTACTCGTGGTTCTGTTCATTGGATGCGGAG
AGCAGATTTTGGGCAGTCATGATGACTCGACGGGCGAGACAGATCTCAGCGTTTGTCTGCGCATTAGGCCATTTCGAGTGGCTTCGCATGCCGTTTGGCC
TAAAGAATGCACCCATGATATATCAACGTCTCATCGATAACGCTCTCTGGGGGTACGTCCAGCCTCGAGATGGCTGGAGTGTGCATGCTGAACGAGTTCA
ATTAGCTGAG