Description :
From Genome Similarity Track
Location :
Scaffold_21:230086- 236495
Transcript NameFunction/comments
Phyin_T30-4PITG_11817Putative uncharacterized protein

Sequence
6409 bases(100 bases per row)
TCCAGTCAAGGGCCTCTTTCTTCTCGGCAATACTCTCGGGGACGCGCTGACTGGGCATAGTGCTGATGTTTTTGCTTGCTGGTTGTAGGGCTCTTCGCTA
AAGTGAAAGTGAGGGCCGAAGGCAGGGCACTGGCTGTAATCGATAATATCTGGAGGGTTTTGTAACTAAGGTTAATCTTGGCGAAATCGTATTTTATTAG
GAGGGGTTTTCAATTTGGAGATGATATTTTATTCGGAAGAATACGTTAAATGTTGTGCATGTTCTACTGTGCTTTTGGCAAATCGGATGGTAGGAGATAA
GATTTATCGTGGTTGACTTAATTTGCGGATAGGAAATGCATGAGCTTGTCCACCGCTCAGATAAGATTTATCACGCTAAAACTTCCCCGAAAATCGAAAC
AAGTCCGTTTTGCCGGTTTATACCGGCAAAATGAGTGGTTGGTGCCTTTTAACCAGCACCAACCTCTCACTATCCAATCGCCCTCATACCGTACTCCAAA
GATCTTTGGTGGCGAGCCGTTGCCCTTCTTCACGTATACAACATTCCACTTCATGAATCGGTGCTGCTAGGTTCTAAGCTGCGGACTACTCGACCTTTGT
ATTCTCTATATCGGAGTGATGGAGTAGTCAATGGCAATCAAGAACAAAAGGAGAAGCGTACCAGGTGACCATCAGCGGTGCTCAAATTTGTGAAAGCGTA
TGTGGAGAGCCACCCGACCTTTTATATAGATGAGGTTAAAATTTGCTGTTTACATGCTTTCCTCTTGTGGTGGAGTGGCCCTCGCAAAACTTACGATCCA
ATCTCACACACCGTGCCCCGGACTACCGACTGACGGAGGGGTACTCCGATAACCGCGGGGTTGCTGAGGGCTCACCTTGTGTACCCATCGGTGGATCTGG
TTACACTCCTCTGGTGGACTTGAAGAGAAGTTTGGCTTGGGTTGGTTCCGTCTTGGCGGGACGCATGATGGTTGGGGGTAGCGTAGCGTGGAAACTCTTC
AGGCTACGCGCCAGGTAGGTGGTCGACCTTGATCGACGTGGGGTGTTGTTATAACTTAACGGGGTCTTGTTTCTTTCCTTGCTAGACTTGACCGCTTCCT
ATAGCGGGGGCGATGAGGACGAGAGTGAAGACGATCGACCGGCCAAGCTGCAAACTCCGGCGACTGACACGTGTACCTGGTAGACTTAGCTTAATTTCTG
TATGGACCAATATACCTCCCGCTACAGTCTCGAAGTCTAAGCCCGAAGACACTTGTTGCTTGTGAGGCAAATTCCACTCTGTTAATAATTAGAGACTTTT
GCGGTCCACTACCTTGCATATCGTATGATCACCAAACTGGCCCTTGAAGGTAATATCGTACTTACCCGGCACGGGGTACAAATCAGTCGATCTACTAAAT
AGATCGTGTATCTAAATGACTGTACCTTACCGATCCGATATCGTGGATTGCGTATACACTCATTGATGCGCCTTCGTCACTGGTGGCATTCCAACACCCG
ATCGGGAGTCGTACCTCATCAATCCACTTCCCAACTTTACCAACGGGTGCTTCACCACACTCTTCTGAAAACGGTATCTACGTCGATAATTTGTCGTGCT
CTCAATTTCGACTTGAGCCTGAGCCGCAAGGTTCTCTCCAAGACTGTGCGCGAGGCAGTTCAAGCAGAAATTCGGATATATAAAGAAAGGCTCATGCCTG
TGAATTCAAACGCCGAACAATTAGTCTTTCCGGACGAAACCTCAAAAGATGGTCGCCATGCATGTCGAGATGTTGTGCTGTACTAGGGCTGAATGAAACT
GCACTAGCAGCTTCGTGAGCTAACTGCAAGCGGGCTTGCTGGACACGCTTCTCCGTTGCATGGTGGAAGTCGGCAGACGTATCAGCTGGCGTCTCATTGG
CCACGTACAAGAATACTAATAATTTGAGCTCACTTTCCGGTGCCCTTCAAAAGCCGCCTCCTACGGTGCATTGACTCGACGAAATTGGCCGCCGACAGGC
GCGTGTATTTGTCCTGATTCTCATTGCTAGACCTCTTCAGGTAGATAGCATTGTCCTCGCATAGTATGAGTCGCTTCTTGCGTTTCAGAACTTCAGCACT
TGATGCCAGTGTGTTAATTTTCGTAATGCGTTTCGCCCAGAACACATCATAGCCTTCGGCTACGTCGAACATGGTGTCTTGTTTCTAGCCACCACGAGCA
TTGCCGTGTGGCGCATGAATAAGAACAGTCAAATTCGCAGTCAGTACTCTGGGCTGCCCGCCTTCTGCTTGGATGGCAGCGATGGCTTGGTTGCAGCTTG
GCTCCATGATGGCAAAAGTAATTTGCAAAGGCAGCACTGAAGAACACACAGGAAAACAATGAGTGGTTCTTTTTAAAGTGATGCAGTGTATTACGAGAGC
TGTAGTTTGCCTATAACAACATATTGGACATCACATAAACTATGAGTACAAGTCTATATAGTCAATACATTGCGGCATAGAGAACAATTTGGGAGAGAGC
TTACTGTAAATCCACTGCTTGGTTGAATGAGATTGTTCGGCAGCATGCCCATGCCTACTGCAACCCCCACTGCTGTTGATAGTTAATTGTGTCGCACGCC
ATCAGCGCCACACACTTGGCCCTAGCATCTTATCGATATCAATTCGCGCAGCATTTACTACACCAAACCGCAAGTTTCGCAACACAAAGACATTAGATCG
TTAATAATATAATCGGCTGACTGATGCACAAACACCGTTGAACACCCCCGGCTGGTCCGGCCATCTTCAAAGCTGAACACCAGGCAAGCCGCCAGCGTTC
TCTCCCGTGTGATGTGCTGTACTCGCCGTGCACGAATAAGTAGATAATATAGGAGATAGGGTGAAGACGCAGAAGCAGCTTACCAATGACAAAGATTGCT
CTGTCTTGGCGTGGCCGGTGCGGTAGCTTGACCTGCCGACGTTGTTTTTTGTGGCTGTGACTGTGGGGCGTCAATGAGGTCCGATTTAGAAAATTTCTGT
GGTGGCAGAATGTAGGTTGTGACTCAGATTTATTTATACCTATCATTTTCTAGGTGCTGTTTATGTCGTCACTCCTGTACGATATCTGGGCTTAAACGGC
GAAGCAAAATAACTGCAAGGCACAATCTGTAAGAAGAGAGAAAAACGCAGCAAAACAAACTGCGGAAATAGATGCGTGTATTCGGTATTTAGGTACGAGA
ACGGATCGAATTTATTAAGAGAACGAGTGTTAGATTACTAGCATTTGCATAAACATGAGCACATGCGGTGGTGCGCATCACGTTGTTAGCAGTTTCACAC
TTCGAAGTAGCGCATTTGTAGAGATTCTAGGTGATTTAGACATACTACAAAGAGACGATCAGCGCAAGGCTGTACCGCCTTGGTCCTCCCAATACGAAAT
CCAAATGATAAGCATCATCTTGCGCAGAAGTGACAGGGTGACGGGCTACCAAAACAGATATTTGTCAATATTTAGGAAACCGTGTTCACAAAGCCTAACG
TTCGATCAGTCGAGGCGTCCTATTGCAGTGATCGTATCGAGTAGATGTCACCACTGTCGTGACAGCGCCATATAATCAAGTTTAAGGTAGGAATCTAGCT
GATGTAACTTGTTAGTGAGCGCAAGTACCGTTTCCACATATACTTGCCTTTCCAGTTTTCCCCTTTTGGACGCTTTTTTTCGCCCTTTTTACCTCGATTG
CCAGTTAATAGTAAAGGTTTTGAAAGCAACACTGCTCTGAAATAAGCGTACAGCTAACCTGCCATGTACTATGTTATTTAGAGTACGATATACAATACTT
TTTTATCTTACAGTATGTTACCGAACTGGTAGACTCCCTTCTTGTAAATTTCCTCGGCGGGGTATGCTAGGTCTATCAACAATCGAAACCTGACATATCG
GGCCTTATGCCAGTTTGGGCGGCGTCCACTACATATATTTGTCGTTGTGACGCATACGTAAATTCCATCTACACTGTATTATTAATGATGACCAATTCCT
ATGTCGCCGCCGAAGGCGATATGGCCTCTCTATATTATACATGTACTGTACATGCCGCTGTTTTTGCCCTTCATCGCTAGAGGAAGCACGTTTGACAACG
TCCCTGTGGTGTAGTGATTTCTCCGTAGTTGCGGATTATCACCCGTCGACAAAGACGTGACACCGCCCAAGTTGTTCAAGCGACGAACCCTCAGTCAGGT
GATGTACGGAGACGCCAAGGTGCAAGGGACTCGACGGCGTCACCTCCGAACGTTCAACGAGTATTGGATACGGGCATATGTCACTGAATCCAGGCTGTCC
TTATTATTAATAATGGACTGGCCGGATTCGCATTCAGCGGACCATCTACGGTACGAACTCTCAGTGGCGGTTGGGATGAGTTCGCAGAAGCCTCAGCGAC
CCTTGGAAGGCACTTTCACCGTCTGGGACAGGGCGCGGACCGTTAAAGATGCTCATGCGACGGTGCAGACGACGCTTGGCATGCAAGAAGATCCATAACG
GATCATTGTTCACTTGATATTTGTATACTTGATTAGGACTTCTTATTAGGAATAGACCCGAAAGGGTAAGCTTAAATACAGAACAGAATTTCCACTCAAG
CACACAGAGCGACGTCCGGCTTCAAGGTAAGCGTCAGGTCAAGCTTGTTTGAGTGTGTTATGCCTGTCGGTGAACTCGAAGCTCTGTAGCGAGGGTTCAT
CCGGCAAGGCCAAGAGACTTTGTGTATTGGCCGATTATTATCGGGAGGTTTTACGTGACGGCTTATTGTTGCCTATTTGCACGACTGGGAGTGCTTAAAT
TGCCTCCCTTTTATTTCTTCTGGCCGAGTGTTGAACACTCGGTGATCTCGTAAAAGGCTTACCCGTGCCTGGTACCCTTCCGCTGTTGGGACCACGAGGA
TTCAAAACACCTGCTAGCTTTGCTCGTGCTAGTAGCGTGTTTTTTTTTTACTGGTTGGCCTATATAAGTAGTTTACAAGGTCCAGTTTGTCCCGGTGCAA
GGGCAGAACTGGGGTCTTCAGGTCCGCCCGAACGATCGTTTACTATCCTAGTAGACGTATTGTTGTGGGAACATCCTAACTACATCTGTAGCTAGAGTTC
ACGTGGGATTTCCAACACCACATCCCTAATACCGCATGCGCATTAAAGTTGTTCCCTACCATGTCATAACTTTTGATCAAGTACTTCGAAGTACAGACAG
CGACGGTGGAATCCGCCATACGTTTGAAACACGCCCGGGCCCAAACATGGTTTCCCACTAAAGAGAACAATTTTAACCAATCCGTATTCCGTATTCTAGC
GTTAATGTATTTTTAAATCAGGATCTGTAGATTCTTGAATCGTTTTTGTACCCTTTGGAATCGTTTTTTAGGCTTGTGTTCCGACTTAGAGCTGAAACTA
CCACTATTCAACCAATCAAATTTATGGGCGGGTATTCCTGTCGCGCGTAATACTTTTATTTTATATGAAGGATAGTATTCAGACACCGGGCGGATTTCAC
CGCCGTTATCGGTACAACAAGCAGATCATGTTTAGGCGATTGCTGTGGTGCACATTCCTAAAATTTAGTGGGGTTCGAACAAAATGTATTCAAATCTGGA
AATCTATAAAACGATACACCTCTATTCAGAAGCTGACTTCCATTGAAATTGCGTTTTCATGTCAATACGTATCGCGGCACCGGTATATAAACCTTTGATT
CGGACCATTTGACTGTTTTTCTATCATCATATTGAATAAGTTTTAAGCTGCAGTATTATCGCCCGTCTCACAGTAAAGTTGCGGAATAATACCAGCGATG
GACCTTAACCTCACGCAACTAGACAAATTCAATCTTGGATCTTGTAAGGATAGGAAACTTGTGTCCACCACCTTCCCTTCAACATAGAAATCATTGACAT
TTTGTACCTGTGCACACTTTATATTTAGAGCTAAATTTAGAGATTGAACATGACACCCCAGTGGGGATATTTATCGGCGAGGACCACATTAAGAAAGACG
TTTATCGCCAAAGACCAATTCTAGTGCTTTAGCCTGAGACGGGTGCACTGTGAAGCTGTGCAATATTAGTCTATGATTCTCCAAGTGCCGCTCATTCACC
ACCACTAACATTGAGGGAAATCACATTGCGCGGTGTGGTAACAAAGCCCAGAGCTGTATAAACCGAGGAAGGTGCGCTGTGTGGTCGGCACTTGAATATG
AAGTATGAAGCTGCTGATGGTAGACACAAGAGTCGGTAAAACCACGTCCTATTCGAAGTCATTTCGCACTTTAACGCAGGCGCTTGTATTTCTTTTGAGC
GTGTACTGAACGCGTCGACGTAACAAATCGAGTTATATCAGAAAAAAATCGTTGATACACTGGTTGTCAACCTCTCCCACTACTCCGTGTTGCTAAACGT
TCCTTAAGA