Description :
From Genome Similarity Track
Location :
Scaffold_544:23006- 24930
Transcript NameFunction/comments
Phypl_g9289hypothetical protein PHYSODRAFT_485789

Sequence
1924 bases(100 bases per row)
ACAGAAACACGGGGCGCAATGCAGGAGACACCATCGCGATCATCAGAGAACAGGAGCTCTTGTTGGGACGTAATGAAGAATGTCGGTTACGAGAGCGAAC
GGGCGGGCGGAGGCTTCTTCGCTGCTTGCAATACGGCTTCAGGCGAAGTGAATAGCCTCCAGCTATGAACAGGCTGTAGTGCGCAGACACGATGTCATCG
TCCGACGTGCCATAGCGTCGCAGACGACACTCGAGTGTCGTGTTGGCATTATTGCGCTGGCCGCGTATGTGCTCTCATTCTTGATACTGCTGGCGTTGGA
CTAGCCGCACTTACCCTAGGTTccgcagtcgtcgctgctcatcACGGGCCCTCACTATTCCAACAGCTGGAGCCGGCCGAGATCAATCTTAGCCCTGTAG
CGCCGGTAAACGATGTTCTGCTCACGCAGGTGAATGCACGGCAACGCGAACTCGTACGATTTACTGGATCGAGTTCAGTTGCGAGGACATAAGTCCTCCC
CCGTCGTGCGTACGGGATATGCAAGCCTGCATCCTTGATACCATTCCTCAGCCCACTATTTATCTGGCAAGGGAGCAGTTCGTCGAGTAGAATACCTGTG
ATGGTATCCCCGAGCACCGTGCTCAGTTATCGGCAAGGGAACCGCTTTCCAGTGCGATATACTGGCGTAGCCCCATGTTGATCGTAGCAATCACCGAAGT
GAGGTAAATCATCAGCCTTTGTACCAAAGGCGCTGTCGTGGCGTTGACCACCATCGGTTGAGCCCGTCGCGGACTGAAAGGGGAGACAGCCGAAAGTTGT
ACAACCCATTCAACCCCAGGCCGGgcggtgtcgtcgtcgtcgtacatGAGTGCGTTGTGCTGGCGGTGTCGGATCGGCTGGTTATGAAACCTCAGGACGT
AACGATCATGTCGCGCAGAGCCCACACTATGGTTGACGTTGGTTATGCGCCGTCTACGGCGAATGTGAGAATGAAATACTCGAGAGAGCAGGTGAGAGCG
TCGAGTCGTCCCGAACAGTACAGGAATCAGGGGAGGAACGAGGGTAAaaagacccccccccctatTTTGATATTCGGACCCGACTTACGAACGTGTGTTT
TCTTAACGCGCGAAGGGGAATTTTGGCCGACTTTGACTGTTTTTTGCGAATTTTGGCTGGGTTTTGGCCATTTCCCTCAACCCTGTCCTCATATTAATGG
ATCGTTGTGCTCTGGTTTTCTGGTAAGGTTAACAAAAAACCTATCCCCAAGTGTTTTTGCTTTTTGGATAATACGAAATACTGATCTCTTGATAGGACTA
TGAAGTCCGATTAACTCTTTCGCGAgtcacttaggtaaactacTTTATACAAGGATAAGTCATTTGATTACAAAAGGGACGCGAAAGTCGCCCTTTTACA
ATATCACAGTACTCTCTTTGCgtatctcttgtaacatacCAACTTCAATATTTGCTagaggtacctgatacatgtAGATACCTTGATTATAACGGAAATT
CCCGAATAATACCCTGTACCCCTCTCGGGGTAACCTCACCGTAACCATAGAGTAACCTCATGTAACCTTGACGGCAATAACCACTCTAGCACCAACCATC
TCACCAGAAGCTACCTCGCTAATCAACTCTGTTACAACCAACCATTCTAGCAGTCTACATACCTATCCGAGCCCCCAGAACTTCCTCATTCAGCAAAATG
TCAACAAGAATCCCCACCAGCTTCTGACGCAAGCAAGAGGTCCTTCGGTGGATCGAACGAGAAAGCGATGGCGTTCCTACGCGATTCATCAAGCGAATGG
CTtgacggtggtggcgtgACCGTGAAAACTGCTAGCTGCTGACCTATCCAGCAGACGCTTGCAGGAGGTGGCCGGCGTCCTCTTTCCGGCGCAATGGAGG
AGGTACTCTACGATGAGGTCGACG