Description :
From Genome Similarity Track
Location :
Scaffold_60:23004- 25816
Transcript NameFunction/comments
Physo_138050hypothetical protein

Sequence
2812 bases(100 bases per row)
CTCGCAAGCCGCCCTTGTCCAGTGGCGCAAGGAACGGAAGGTCTATGAAGACATCATGAGAGAGCACTGCCAGACCTCGGGAGAGGACTACGCTGCGGTG
ACGAGATCCGTGAAGGATTCTTTCGAGCGGAAGCTGCTAGAGACATGGTGTCGGCTCCGGTGGCAAGTTGCAGTGACTGAAGTCGATGACGACAGACTGC
GTAGCGAGATCGACAACATTATCAACTCCGTGAAGAACCACACTCTGCCCGACGTGCAAGCTCTGTTCAAGAAAGAGTTGCATTTCAACCTGAAGGAGAG
TGACGTTAGCGAGCGAGTGCTGCAATATTTCATCTCCTGCGAGCGCATAAGTGAAGAACACGGCCTGCATGCCTGTTTTGAGTCGGAAACCAGGCGGAAA
GAAAAATGCAGTTTGCTGGTCAACTCGATTACCCCGGAAGGATTGAAGGAGGAGGTGAAAAACGCCTTGCGGTACCAATCGCCTGGAGCCAAGACGGATG
AGTGCAAGTTGCACGATGTGATACTGGCCAAGGCACTTGAGCAGGACCGAGACTTTCGGCGATCAAAGAAGAAGAGGGTCTCGGATGATGTTCAAACGCC
ACGTCAGACACACGAGCGCGGCGGAAAGAAGGCCAAGCTCAGAGCCGAGTCTGGCGTGCACGGACAGCGAAAAAACCATGACTCACGCAAGAAAGAAGGT
GCTCCTGCGCGAAATCAACCACGTCCGGAGGCAAAAGGAAAACCTACTGCTACCGCACCGAAGAAAGGATGCCTAAAATGCGGAGGACCTCATTGGCTTT
CTAAGTGCCCTGAAGCCAGTGACGCTGAGAAGCGAGACTTGCCGAAGCAGTTCTACAAGAACAAGGACAAAGCGTCCAGCGATGTGAACATGAAGCGACT
TCGCGAGGAAAACTGAAATAAGGCGGGCACCGTTCTGCTGAATGGTGTCCTCCGAAAGCCTTACTGCGCAGATACTGGGTCGAGTCGGTGTCTCATCAAC
GTCAAGACGCTAGCAGAGCTCAACGCAGTAATGGGGAAAGAGATCTCGATAAGGAAACGGGAAAAACCGATCAAGGGCCGTGCAGTTGGGGGGCATTGGG
TCGAGGCTGTGAAAGCTGTAGACCTGGTCATCCAAATTGGCACAGCCGCTGGCATCGTTGAACACCAGAAACCTGTCGAGTGTCTGCTAATTGAAGATGA
TGATGATGAATTTATCGTGGGTAAGGACTTGTTGAAGCCATTGGGAATTGATGTGGACAGGTTGCTGGAGCAACTTGCACAACCTCAAGTCAACGACGAC
TGTGATCCATACGACAGCGTTGACGATAAAAGAACTGAGCATCCAGATCTGGCAGAGATCATGGAGCAGTTGATCAAATTGGTTGACGATGCGATAAAAG
CGGGTTTCCCCGTAGCATATCGGCATCAGTTGGAAGAATTAGTGAGGAAACACGACATTTGGCGCATCGATCTCCGGAATGACCCTCCTGCGAGAGTACC
GGCTTACGAGATTCGATTGAAGAAGGGTGCAAAGCCGTACAGATGTAAGCCAAGGAAATACTCACCAGCCCAAAGCAAGTTCATGAGAGAGTTCAACGAC
AAGCTTGTGAAGCTGGGTTGGGTATACCGGAACCAGGCCAGTCGATGGGCGTGTCCTGCGCTACCAGTGAGAAAGCCGGGAACGGAGGATTTTCGACAGA
CAAGCGACTACAAGCCTTTGAACGCTTTGACTGAGCCTATCGCCGGAGTCATGCCAAATCTCGATGCAAAGCTGCAACATGCCAGGCACAAGAAGCACTA
TGGACTTTTCGATTTCATTAAGGGATTTTGGCAACTACCGCTGGCTGAGTCGAGTCAAGAGATGCTATCCTACGCGACCGACGAGGGCGTCTTCACACCA
ACTCGAGTACCTCAGGGTAGTTGCGATGCGGCCTTGCATTTTCAGGCTACAATGGAGAAATGCTTTGCTGAGCTGGTCTACAAGTCTCTGCTGATCTGGA
TTGATGATCTGCTCCTGTTTGCAGACACCATCGAGGAATATCTGGCGGCACTGGAGACTTTGTTTGACACTATGGATCACTATGGGTTGAAGTTCAGTGT
AATGAAGACTTGTTTGTACCAGCAGTCAGTGACCTGGTGCGGCAAAGTAATTTCAGAGAACGGCATCACGCATGATCCCAGACGGATCAATGCTCTGTCG
AACATGCCTCCACCGTCCCCGGCAGGTGAACTACAGCAATTTATCTGTGCATCAAATTGGATGCGCGATAGTTTGATCGACTACGCCCGAACTATACAGC
CACTACAGCAATGCTTGGATCGAGCGCTCGAGGGAAAACGAAAGACCAAGCGAGTCGCGGCTGGTATTGCGCTGCAGCTGAACGAGTCGGAGCTCGTGAG
TTTCGACAATGTAAAGAAGCTGTTGGCGAACTCATCAACGCTAGCCCATCCGAAAGACAGCGCAACCTTCGCATTAGTTTGTGATGCATCGGATGTTGGA
TGGTCGGCCATTTTGACTCAAGTGGAGAGCTGGGATGACGCAAAGCCTGTGACTGAGCAAAACCACGAGCTTTTGATCTGCAAAGGAGGGACTTTTACAG
GCGCGCAGCTACACTGGTCGGTCACGGAGAAAGAACTGTTTCAGCGTGTGACGACTTGAACTACCTGTTGCTGCGGCCTGGGGGCTTTAAAATCTTTTGC
GATCATCGCAATTTGATTTACATGTTTGCACCACACCCGGAAACGAAGAAACATGTACGAGGGAAATTGCTTCGATGGTCACTCAAATTGACGGAGTATC
GCTACACTATCG