Description :
From Genome Similarity Track
Location :
Scaffold_1156:2300- 4180
Sequence
1880 bases(100 bases per row)
GTGATCGTGTACGCCAGCGACTGGGCGATCTCAGGGGTGCTCACGCAGCTCCACGACGAAGTGTACATGCCTGTGAAGTTCACTAGTCGTACGTTGAAGC
CCAACGAGCTGAACTACGACATCGTCGAAAAGGAGATCTTGGCCCTGTTGCGCGTCTTAAACGAGTGCTACACGATGCTAGGAGGGAGACCAGTCCACGT
CTTGACACGTCACACGACACTCGCCTGGTTGTTCCGGTCCAAAGGACTACAGGGGCGACTGTCACAGTGGGCCGCGATCCTCTCGCCGTGGAAGTTGGAA
ATCTGCTGATCCATGAAGGGAGAAGAAGAACTCCTCGGCGCGCTGGCCGCGAGCATTACCCCGCGAGCCTTCGTCGACGCGGCGCTAGAAGAGATCGCCC
CACGGAGACGGGCGTCCAGGATTGTAGTCATTCCAGTCCCCGACGTGGCGCACGACGAGGCCTTGCACGTTTTGAGCTTTGACGGATCGGCCAAGGCGAA
GCGAGAAGGCGGAGCATACAGTGCCGTCATTTGGCAGCTGCCGAACTGGGAGATCGTGCGCGCCGCGTCGGGATATGCGACGGACCTCACGATCAACGAG
GCGGAATACCGCGGGCTGCTGCTCGGATGTTCTCTTCTAGAGGAACTCGACGACGTCACCCGACTCGTCGTATGCGGAGACTCCAACCTTGTCATCAGGC
AGATGCGGGACGAGATGGACTGCAAGTCCCCGGGGCTGAAGCTGCTGCGACAAAAGACGCGAAATGCACTCCAGGCATGGCCGCGCCACGAACTCTTCCA
CGTACGACGAGACTGGAACGCGAGTGCCGACATGCTGGCTGGACAAGCTCTGCAGCGTCAAGGAGGTCGCAACGCGCACAGCCCCGAAGAGATTCAAGAT
CTGAAGACGCTGAATCGCTTGGAAGAAGTCATCCGACCACGGGCATCGAGTCCCGAGATGGCGTCTCCAGCCAGTCCCGACGCGGAAAATCGCGACGCGG
AAAATCGCGACACGAAAACGCGCGGCGCAGATGACCCCGCCGGGAAGGCCATGGACGCGGGACGCGGGACAGCACAAGTCCTCGCGGTGACGACGCGCTC
GGCTGCCGCACGCACGACAACACGTAGGGCCCGTCCTCCAGAAGTCCTGGAGGAGCGGGTGGTGCAACGACTGCGCCTGGACCGCATCCACGTCGCCCAG
GACGAAGAGGTCTGGATCGTCAACCTCAAGAAGTATCTCCGCGGCGACGTCGGAGACCTATCTCGGCGCGAGGTGAAGAACTGCCAAAAGCTTGCACCTC
AGTACGAAGAGGGCGAAGGCGGGCTGCTCTACTACTAGCCGAGAAGCGACGATTCCGCCGAGGATCGCGATGTGATGATGAAGCTGGTGATCCCGGAGAC
TCTTCGGGAAGATGTACTCCACCACTATCACGCGAGCCTGGAAGGCGGACACCAGGGTATTGGCCCCACGTACCAACGCGTGAGGCGCCACTTCCATTGG
CCAGGGATCTTCAGAAGCGTCCAGCGCTACGTCGACGAATGCACCGACTGCGAGACGGGAAAGGGTCGGCCGACCATCCAGGGCGAGTCGCCGGGCAACA
TCGTCGCGACGTACCCGTTCCAGGTCATTGCCATGGACCATATTCCGTCGTTGCCGGCATCCTACAAAGGCAACACAGAGCTGTTAGTCTGGGTCGACCT
CTTCACGGGGTTCGTCGTGGTCAAAGCGAATGCATCACGAACCGCGCAGACGGTGGCCGAGGCGTACGAGGAGGCGGTGTTCAGGGCTTCGGCGCGAGCG
AGGCTATCCGCCACGACCGCGAGCCGGGCTTCATGTCCGACTTCTTCAAGGCGTTCAGCAAACTCATGGGTCAGAGACAG