Description :
From Genome Similarity Track
Location :
Scaffold_711:230- 4918
Transcript NameFunction/comments
g16985.t1hypothetical protein
g16986.t1RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum

Sequence
4688 bases(100 bases per row)
CTACTGGATTCTCTACTGGATACACTCTACTGGATTCTCTACTGGATACACTCTACTGGATTCTCTACTGGATACTGAGTTGCTTCAGCCAATCAGCGAC
TGCCACGTGGATGCCCATCTTGTACCCACAATCTTGTACCCACGTGTCCCGTAATCCCGTAGCGTAAACAGCGTCCCATCATCAGTGTCCCGCGTCCCAT
CATCAGTGTCCCGCGTCCCATCATCAGCGTCCCGTCAACACAGGAGTGATTGCGGTCCCACTGAGTGAAGGTCATACCGGTATCCTACCGGTATCCCGCA
GCTGCCCGAGGCGCCTTCTTGACAACACTCCCACTCGATTCGACAGCGATTGCACCTTGGATCCCGAGCTTGCTCCGGAGCACACCGAACTGCACCGCAG
TGATCGCCTTCGTCATCATGTCCGCCAGCATGTCCGTTGTCGACACATACTGCAGCACCACTTGACCGTCTTCCACCTTCTCGCGCACGAAGTGGTAGCG
AATGTCGATGTGCTTGGTGCGTTTGTGGAACTGCGGGTTCTTGGCCAACGCGATGGAGCCTTGGTTGTCCTCGTAGATCTTGACCGCTTCATCGCTTGCC
ATCTCGCCGAGCTCGCACAGGATCACCTTGAGCTCTTGTGTCGCCTCCGATAGCGCCATGTATTCTGCTTCCGTTGAGGACAGCGCCACCGTCCGCTGCT
TCTTGCTCCTCCAGCTGATGCATCCGCCGTTTATCATGAACGCGTAGCCGCTTGTGCTCCGTCTTGACTCGATGTCGCCGGCCCAGTCCGCATCCGAATA
GCCGTACATACCAAGGCTGTCTTCCCGTGAGAACTCGAGTCCATGCGTAGGCGTCGCTTGGAGGTACCGCAGCACACGCTTGAGGGTTTGCCAATGCGTC
GGACACGGGTCGGCGGAGAACTGGCTCAGCACTCCCACTGCAGCAGCCAGGTCCGGACGCGTTGCCACCATCAAGTACATGAGAGCACCGACGGCACTCC
GATACGGCACGTTCTTCATCGTGTTTTCATGCTGGCAGCCACCCTCACACATGTTCTTGGTCAGCTTGAGTCCGGGGTCTTGCGGCGTCTTCACAGCTTG
CAGTCTTAGCATGCCGAACTTCGGTCAGGGATGGACTTGAGATAACTTGGTCTGCCGCACCGCTCACTTTCCGGATGTCGCGGCGTTCTTGCATCTCCAT
CCCGAGGAGTACTCCAGCTCGCCGAGGTCACGTTCATCTCAAGACCGCTGCTCAACGCCGGTGCTTGGCTCATTCCAAACAGCTCGTCGTTGCTGCGGCG
AGGACCAAGTCGTCGACGTAGAGCGCCACGAAGATCATGTCTTGGCCGTCACGCTTCAAGTAGACGCAGTGGTCGGACTCGCACTTCTTGAACCCCAGCT
TGAGCATGAAGTCATCGATGGTCTGGTTCCACATGCGCGGCGACTGCTTCAGTCCGTACAGCGACCGCTTGAGCTTGCATACGTGGTCCGGGTGGGCTTC
GTCCACATAGCCATCGGGCTGTGCCATGTAGATGTCTTCGTCCAGCACACCGTTGAGGAACGCAGTCTTGACATCCATCTGGTGCAGCTTGAGACCATAC
TTGGCAGCTAGACTCAGTACGATCCGGATCGATGTGAATTTGGCCACGGGTGCGAAGGTCTCGTCGTAGTCGATGCCGTACTTCTGCGAAAACCCCTTGG
CCACCAGTCGCGCCTTGAACCGCTCGATCTCTCCAGCTTGGTTCTCCTTCACGCGAAACACCCATCTGCAGCCGATCGCCTTGCGTCCCTTCGGCAGTGG
GTGGTACGACATCCCACATGTCGTTCTTGAGCAGCGAGTCACACTCCGAGTCGCACGCCTCCTTCCACTTGACTGCGTCGCTGGATTCCATCGCCGACTT
GAACGTGGTCGGCATTTCTCCCACTGAATCCACGACGTACGCAGCTTCGAAGTCCTGACTTTCCTGAGCCGCAGCCGACATCTCGTCCAGAGTCTGGTGT
CGACTCTGCGACGCATACCGCTTGGCACTTGGAACCTCCGTGACTTCCTCCAGCGACTGTGTCCGCGGGTGTCGCTTGTTGCCGGGCCCGAAGTCTTCGT
CCCGCGCAGCTTCCTCTTCTTCCTCTTCTTCGTTGTCGTCTTCATCCGACTGCGACGAAACTTGATCCGTCGTCTCTTCATCTTGAATGACCACCACCTC
CCTCTGATGGTAGTCGCGTCTCCCACTGTCGAAGACGTCTTCCATGAACTGCGCGTCGCGGCTCACCAGCACGCGACTGCTCTCCAGTTCTTCGAATCGA
TACGCTTTCCCGTGCTCCGAGTACCCCAGGAACCGACAGCGCACCGACCGAGCGTCGAACTTGGTGCGCTTCGCCTTCGGCACGTGCACATACGCGTGGC
AACCGAACACTTTCAGGTTCGCCAGTAGCGGCTTCTTGCCCGTCCAGACTTGGTGCGGAGACTTGTCGTGGCTGACGGCGCGTGTCGGACACCGATTACG
GAGGAACGTAGCTGTCATCACTGCTTCACCCCAATACGTCTTGGGCAATCCGGCATGTTCCAGCATGCAGCGCGCACACTCCACCAACGTCCGGTTCATC
CGCTCAGCCACTCCGTTCAGCTGAGGCGTGTACGGCGGAGTGAACTTCTGCACGATACCGCGGTCCGCACAGAACTTGGCCATTGCGCCGGAAGTGTACT
CGCCACCGTTGTCGCTCCGGAGTGTCTGCACGCGCTTGCCGGTCTGAGTTTCAGCAAACGCCACAAACTCCGCGAACTTGGCAGCCACCTCGGACTTGTT
CCTCAGCAAATACACCACACAGAAGTGCGACTTGTCGTCGATGAACGTGACGAAGTAGCGCTTGCCCCCAAACGTTGGCGTCTGCATGGGGCCGCACACA
TCGCTGTGAACCACCTCCAGCACGTGCTTCGCACGGTTCGGGGACGATTTCATGTAGCTCACTCGCGTTTGCTTGCCGAGTGCACACCCGTCGCACAGCT
CCCACTGCTTCACCGACGTCATGTCGATGCCAACACCGTAGCTCTTCTTGACGATGGCGTCTAGACCGCCATGGCCGATGTGACCAAGTCGGAGGTGCCA
GAGGTACGACGTGGTGTCCCCTTGGCGATCCTTCGAACTTGCCGCATTGGACTCGTCAGGCATCATCGGAGTCATGCACAGCTTGAACAGCCCTTTGCCC
TCACGAGCGCCGAGCTGCCACTTGAGACCCTTGTTGTCCGCGAAGCACCCGTCGCTCTCGAAGGTCACTGGTCCGACGTCCTTGGTGAAGCGGCCGACCG
AAAACAGGTTGCGCGACAGCTTCGGGATATGCCACACATTCGTGAGCACACCCTTCTTCATGCCGCGCGGCGTCTTCATCGACATGACAATGTCGCCGGT
CCCCACCGCCGGAGCCATCTTCTTGTAGTTCCTCATGTACGTCTTGGAACTCGTCATGTGCTGCGTCGCACCCGAGTCGACCAGCCACATATCACTCGGC
TTGGCGGTACTGCTCGTACGACCAACCGAGAAAAGGTAGTCGCCAGGATCTTCTTCGTCCTGCGCGACGTTCGCACGCTGCGACCGATATCGCTCAGCGT
CGTTCTGGACCCGCGAGGAACACTCCGCGATCCAATGTCCTTGTTTGCCGCAGTTGTGGCACGCGCCGGTCTTCTTCACCGGTCGGCCCTTGCGCTTGTT
GTCTCTCGTCATGAACGCTTGACCTTGGCCGTGCGCGGCTCCGTCGACGCCGCCGCCACCTTGTTCCTTGCGCTTCATGTCCTCATGCAGCAGCCGAGAC
GTCACGAGTTCCCACGACAGCGAGTCGGCTCTCGACTCCAACGCCGTGATCAGGAACTGGTACGACTCGCTCAGACTGCCCAGAAGCGTGATCACCAAGT
CGTCCTCGCTGACCGGAGCGCCAACCGCGTCGAGCTGCTCCGCCAGCGTCTTGAGCTTGTTGATGTGCTCCAGCACATCATCACCTTCGTCCATCATCGT
CGTGAAGAAACGCCGACGAAGAAAGAGCTTGTTGGCCAAACTCTTCTTCTCGAAGTGTCCTTCCAGTCTTGACCATGCATCATGCGCGTCCTTGGCCGAG
CGAACCAGCGGCAGCTGCGAGTCCTCCATCGCGAGACAGATGATCGCCAGCGCCTTACGCGACTTCCTCTTGAACGTCGCTTGATCCGCCGTGGTCGTGC
AGTGCTCCAGCTTCACTTCCCCACTCGTCACTTCCCACAGTTCACGCTCCTCGAGCACCATCTGCATCTTGAACTTCCACGTGTGGAAGTTGGTTCCGTT
GAACTTGTTGATGCGGGCGGTCGTGGTCGGGGTGGCGTCCATGGCGAAGGCGTAGTCGGGGTCTTGGTCAGGGAAGACGGGGCTTGGGCTCATAACCAAA
AGGCTTTGGTCGGCTTGATGGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAAGCCTACTGGATTCTCTACTGG
ATACACTCTACTGGATTCCTTACCGGATACTGAGTTGCTTCAGCCAATCAGCGACTCCCACGTGGATGCCCATCTTGTACCCACAATCTTGTACCCACGT
GTCTCGTAATCCCCGTAGCGTAAACAGCGTCCCATCATCAGTGTCCCGTCAACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCA