Description :
From Genome Similarity Track
Location :
Scaffold_1213:230- 3030
Transcript NameFunction/comments
Phyke_g11713hypothetical protein PHYSODRAFT_330841

Sequence
2800 bases(100 bases per row)
TCGGTAGTAGCTTGGAAGACCAAGTTCTGCCATTCTGCATATCGTCGTGATCCAACGGAGACAAATCCAGGCATCCGAGGTACGTGATCTCCTGACAGCC
ATATCCCCACGCGAGTATCCATCTGAAGGGTTAACTTACGATCGCTTACGTTTGTCAATTGCAGGTATCGAGATCTTCCTAGGCCTTTGATCACCGTAGG
TACCCAAGATTCACCTCGCGTTATCCACAGTGTTTGATGGTCTGCTAACCTCGTGTGTAACGGGATCTCGATCGATCCTGCGACAGGGACTTCGAGGTGT
TGACCGAGGGCCACCAGCCGAGCGTTGTGGCTGAATAACTGGCGACGTCCCGACAACTGGATTCGCACTTCGTCAAGCAGGCAGAGTGATCCGTCAGCCA
GATCAAGATGGACGCCCGCAGGCACCATAAAATCCATACCGAGGATCGCATCTTGACCTACCTGTGGCCCCACCCACACGCCGAAGAAGTACACAAGTGA
TCCTGCCAACGTGACTTTGACCTTGGTACGTCCCTCTGCAACATAGGCATTTTCTCCAATTCCAATACATTCTTGCTTCTGACTCTCATCAATGTAGCAC
CCCACCTTACGAGCAAAGGTGGTGTCCAGAATAGACACCTCGGCGCCGGAGTCAAGAAGTAAGTTTGCCTTCTCATTGTTGACCTTTCCAACCATCTTAG
CCTGTCAAAACCACTTACCAGGTGCATGATACTTCCAGTATCCACGCGACTCTCCTGGCAGTAAGTCCAAAGCCATGGCTACATCCGATCTGGCGAACTC
ATCCACCCGTCGAACACTCATCACAGCAGGAGTACGTTTCCCACGAAGTTCATATGTATTGTCGATCGGATTCATCAGCTCACTAACCTTTGATCCCGAC
TGTTTCTCGACATATGCAAAGATGCAGAGCCCAGAACGCTCGGCTTGTACCGGATTCCAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCAGCGTTGGC
AGGTAACATGCCCGCATGTTTGGTGGGATTGTACCACTGGCGGATCATGTTGTAGAACTCCTCCATTGGACACTTTCCGATATCATGAAGTTCACCACAC
CCACGACATACGAACAGGCAGCGATCTGACGGGTGTCCTTTTTTGCCGCATTTATGACAGGTCAACCGTTTCCAGCAGCCCAGATCATTATGCTTCAGAG
ACCCACAGTGAGAGCATCGAGTAGTTGGTGTTTCCGTGTCTGGCGATCCAAGACAAGAACTTCGTTCGTGGTTCTCCTGTTTGACGAGGGTTTCAGCCGT
CGATAGGAACATCTTGCGTAGATTGCCTTCACTGTCGGATCCGCTCGATTCCGGCTCCGATGCACTGCTATTTTTAGCAGCGTGGATCACACGTACGGCC
CTTGCCGCCGATGGCGGTTTTGCCGCTACTGGTGGAGTCGATGTTGCAGGAGCCTTCTGACGGTACTTACCGGACCCAAATGCTGCCTTGCTCTGTCGCG
TCTTCGCACGTTGACGTGCACGCAGGGTTTCTTCCAAGTCACCGGCATCAGCTAGACGCAACAAGGCCAATTGGTCGGCCAGGTCACGATCATCTAAAGT
CTCGATGAAGTGATCCACGTGTCCACGGCATGCTGATGTCGATCCATCTTTGACACGGAGTTTCGCACGCATTCCAGCGACGTTCAGGCGATGTAGGTAT
TCCAACGGGGTTTCTTCCGACTTTTTCCGCGCATGGTAGTATTGTCTTGCGACAGATACTCCCAAGCCACAGTGCTGTGTCTGGAACTCTTGAAGGAGGt
ccttccagttgctgcGGGCAGTACGGCCCAGTTGACGATACCAATAACGGGCTGGTCCAGTGAGCAGATCACCGAAGGTCAAGCATTTCTCTTCATCCGG
TGCTTGGTCACGAACGAATGCAGACTTTGCCTTGTTCAACCACGATCTGGCACGATCTTCGTCATGATCCTTCCCCGTGAACTCTTTCAGCTCTGAAATG
GCTGACACGCGAATTCGTGGGGCGATCGCTGTCCCGATCGATGTAGCCGCCGTTGATACCATCGCGGCCCGCTGTGGGACAGCAAAGTCCATCGCGTCTG
GATCAAACTCGTGGATCGATTCCATGTCGACGTCTGGATGAtccaccatctccacttCACCTTGAGCCTGCGGTACCAGTTTCAGGTTCTTGTCCTTCAA
GAAACGATCCATCGGTACATGAAAAAACGACTCCAGCCTCTCCGGAGTGAAACCCGTCTGGTTGGCAGACCTGGGATCAGTTGATGGAACTGGTTCAGGA
CTTGGTTCGACCACTGGGACGTTGGGACGTGTCCGACAACTGGATCGTTCTTTCAGCATTGAGACACCTGATGGCCCGAGCGTCATTCGCTTCGTTTCAC
TCGAGGTGTCCGATCTTGCTTCCGATGTTGCGGACGCGTAACAGGATGATCCTGTGTGGTACTCTGCATTACGAACTGGTGGTGGCGTCTCGACAGCACG
GTCACTGACTACAGCTGACAGCTTCTCGTAGAAGGTCGTCAAGGCATACTGGATCGCGTTTTGCTCGAGGTCGAAGAGATCTTCGGCTTCGAACGCCTGT
GCCACGATCCCGGCTTCCTCCATCAGACGTAGTAGCGCCTTGACCGCCTCCAGCTTGTTTGATACCTTCGCTGGGGCAGTCACTGGCCCTTTCCAGTTTC
CGAGTGGATGTACCTGCATGATCTTCATCACAGGGTTCTTGGTCATAAACGTATGAAGCTCCTTTCGGTGGTAGGCGATTTCCAAATGTTCCTCAGTCCA