Description :
From Genome Similarity Track
Location :
Scaffold_220:230- 20545
Transcript NameFunction/comments
Phyag_g3626hypothetical protein PHYSODRAFT_532982
Phyag_g3627hypothetical protein
Phyag_g362860S ribosomal protein L13, putative
Phyag_g3629folate-Biopterin Transporter (FBT) family
Phyag_g3630hypothetical protein PHYSODRAFT_566444
Phyag_g3631hypothetical protein PHYSODRAFT_362528
Phyag_g3632conserved hypothetical protein
Phyag_g3633conserved hypothetical protein

Sequence
20315 bases(100 bases per row)
TACACCCGGACTCCAGAAGTCCCGTGGCACCTACATAGCTCAAACACGTGTAGTACGGAGGTAAGTTGTTCTCTTGCATCCACTGCGCCACGTCGAGGCC
GATATCTTCTTGCCGGTCGAACAAATTCAATCGCAGAACTCCTCGAGACAGAAACACTCGGCACGGTAGTTCGAAGGTTTGCATCTGATCGAGTCAATAC
ACATTGCAACAAGTAAGACATCGTGACAATGctgccaacttcaacaataCTCTCGTACCTGCATATCCTTGGCGATACTAAACACCATGGACTCGTAGAC
CAACGTGCCGACTTGTCCGTCGTCTCCCAGTTCATACAGTGCGAACGATAACCGCTTCGGGGAGTACGTCGGACTACCAGGGTACCAAAACACCCTGTAC
GGCACAACCTGCACACTGTTCACCAGGCAGTCTTCCCACAAGGTGTAGTCCAGATAATCTGTCGTCGTATAGCCCCACGTCGAGGCACTACAATTGAAAA
ACAAAtccaaaaaaaaaaatcagtACCCTCACTATTTTCTCCTCCAATTTTCCTCCCTGTATCCTGTACCTGCTCCAGTAGCACGGTTGGCCTCTCGCAC
AGCCGCACTCGAATTGCAATCTCTTGGCAATTGCTTCAAAGGACACCGGGTCGTTTGCCACCACCGTATTGGACAGCAACGCCACCCCAATGCCGCAGTG
AGACCTCGTCAACGTGTTCTCCGCCGACTCATTCGTGTGGTCCACCGACGAGCACTCTacccaccagcagcagaatagTTGTTATTTAGTAAAAATCTAC
TGCTGAACTGCAGCTATTGGCAATTGTATCATTGTATcacctcgaactcgacgtaGCACCGAGAGTTCTTCCCCCACGGGACTTTGCGTCAGAATTGCGA
GACGTTTCCAGTCGGCGGAACTTCTGCTGCGATATTCACCCGCATAGAGAGCTAGACGTTGCGCTAATAGTCTCCACGTATCTAAGTAACAACACAATGA
CACAAAAAAAGAGGAATCAGATCAGCTCGTTGAGCTTCGAATCCGAAGAACGCACCACACTGGACGATGGTCTCCCGCACACGGCGGCTGACGGTCTCTA
GCTGTAGCAGCGTGGAGTGGtcgacgaactgcagcatcgtcgccAGGAGGTCGCTCGGCAGGTCGCACAGGCCCATAGAGACGTTTTTATTTTACTACTA
CTAGTAGTATTAGTACAATTTTTCACAGGTTCAACTATTTTTATAGAGGATGACAgggacaacttcaagttAATTAATTGCTACTTCAGAAGCTCTGACG
TTATCCGTGTTGCCGACGTTATCTTCTGTATGTATACACTGCAATGCAACTGCAGCTAGTCTTCCCATCGATTGAGAGCTTGGCGAAGCATGCGCTGGAA
TTGAGACGTGGCGGCGCgttccttctcgatctcAACGCGAAGACGCTTCATCTCGCCCATTGCTCGGTATTTCTGCACGGGATCGCCCACAACTCCAAAG
CTCCGTCTTATGATCTGCATGGAGACTGTCGGGGCAGGTTGTTTCGCGACAACGCGGTCACGCTTGGGATGTTGACTGGGAACAGGAAGTTGCTTCGGTA
CTGAATTGTGCGCAGCTTCGATGAGACTCGTCACCCTTGAACCAAATTCCCGCCAGTCCGCCGGGTAGTACACGGTGATGTCGCTCAGTGTCTCGAAGAA
TGTATCGTAGATCTCCTCGAAGATCTTTCGCCATGGCAGCAACGCATCGGCGTCTCGTGGGGTCACTTGGTCAGATTTGCCGTCGTGCGTCAGGCTCTCA
TGAACTGGCAAGAGCACAGTGTAAAtccgcttcttgagctcgtacGTTGACACTGCAGTCGATGCTGGGTAGGACAGGAACAGTCGATCGATGAAATCCT
CCAGCTTTTTGAAGTAGACGTCGCATGTCAGATCGCAGTTCACTGCGGACGTCTCGCTGACGATGCGAGTCACTTCAAGGGCCGTCAGCACCGTCCTAAT
CTCGTGTCGTCTCTCCTGCGAGTTCCAACCGGGAGGAGGATCCATGATAGCAAATTGCAGTTCTGGTGGAGGGTACACGAGGTCCATAATACCAGACGTC
AAGATGTCTTCGCGCACTCGCGGGAAAACCGCGCAAATGCTGCTCTGCATGCCCACTGAAGACTCGAACTGGTTCATTATAGCCTTGACACTGCCCTCAA
GGAGCTCCTTCAGGCCAACGCTCTTGAGAGGACGTACTGGCGGGGATAAACCCGCAATTTTCTTCAACAGTTGTCCGAACTTGTAAGGAAGAAGGTCGCC
TGCGTCGATAGGCTCAATGTAAGCTTGGACCGCCCTCGAAGCGAATCGGCTCTCTACTCGCTTGATACAGCTCCCCAGCGTATCCATGAGAGATTCTCGT
GAAGAAACAATTTCTGCTGAAGCGAATCCCAGCGCAACCACCGTCACCGGGAATCCTGGCTCCAGCAAACTGAGTAACTCCTCAACTCGATGTTCCCAGA
TATTGCATGTACCACCTTGCTGTAGGGTACTCAGATCGACGGGTAGTAAGATCGCTGACGTCGCAGCGAGCTTGGCTTGCTGTGCCTTAATTGTGTTCTT
CTGCGTAAACGTCGAGTCAAGGTATCGATTGCAGATTGCGACATTCTGCGCCCCGCTGGACTGGAAAACGCGATAGCAGTCATGATCGACAGCAGAGACA
TCTTGCGTTCCAGTTCTGACCGCACACCACAAGCCAAATGACGAAGACGCTTCATCTAGTAGATCTGCAACCACCAATTTCCATGCGATAGACGGCGCTA
CGGGGCTTTGCCGGCGAAGAGAAGGACCGACCAGTCCTAGGATGTCATCAGAGCACCAAAGCGACAGTATCTCTGCATCTGAAGGTGGCTCGCTTTCTTC
TGACCTTGATACTTGCTTTAGTCGCTTAGTACCAATGGGAGTGCCAGATGATCTGTTGGCCCCTCGAAACAACCATTGCAAGCTCTCTTTAGCCTTTTGA
TGAGGCcgatcaagttgaagtttagTTGCGTCAATTGCAACTGGCCCAGGACCGTTCCGTGACACTTGGACATACTTTTTCCAGATGTGTAGTCTCAGTT
TCAGACGGGCAAGACGTTGCTTTTCAGCGCGGCGCACACGTTTCCGTTCTGCTCGTTCCCTGGCCAACTGTGCTTGCCGTTGCGCTtcgagagcagcttc
acgtgCTTGACGAGCCCGAGCTTCGGCTAGTTCTTGCTGACGACGTCGTTCAAGCTCTTTTGCTTCTCTCCGTcgaagttcttcttgtctcagttcttct
tgtcgacgccgttcttcttcagcagcctTTATCCTCAtagcttcagcttgttgcTCCGCTAGAAGTTTTTGTCGCTCTGCTTCGCGAGCTGCCTCTTCGG
CCCGCTTGCGCTGTTCTTCCAACTCTCGCTGCTTTTTCTGTTCACGTAGCTGGGCTTCAATCAcctcctgctgttgctttgcttcagcagcttccttctc
AGCTTGAGCTCGAACGATGGCTTCTTTCTTCGCCTGTGCTTCGTCTCGGGCAGCCTTTTCAGCAGCTGCCTTCGTAGCTTGATCGCGCCGTGTCTTCTCT
TCCTTCGCTTTCTCCAGTTCTCGCATTCGTTGTAACATCTCTTGTTTCTTCTGCTCTAGTTCCAGTTTCCTGTTAGCAATCATGTCAAGATCGTGCCTTC
TCTGATCGGTCTCTGCTGGTTGTCTTTGAGAGGAGAAATTGTTAGGCGGTACTGCTTGGGCGCCCGCTGGAGGCGCCGTGGGCACTCCTTCGTTGTAGTC
AACGAAGTAAGAGTAGTCGTCCTCATACTCGGGTCGGTCCGGGTACAGTCTTGCCTGTTCCTCCCGCTCAGAGTCTTGGATCAGCTTGCTAAGGGCTGGG
TACTCATCTCGACCGTATTCGGTCACTCCGCGACAGATATCTCGCCGTAAGTAGTTACTGCGCAAACAAGAAAATCGATGAGATGCAGCGCGCATTAACC
CCACCACCAATTCATTCGTACCCTTGCTTCATCCCAACGTAGATTTTGGAGCTTCGTATCTTCAAAGGCGTGTTGTCTCGCCGTAGTTGTGCATCTACAT
GAGAGGGAATAAGCAGGGGACCGTCACTTTGTGTGCCACCAGTTGAAGCATTCCTAGTAAACCAACATCATTCGTACCCGTTTCGAAGTCGCCACCAAAC
TTCACAATAATGGCACTGTCATCACCAGTGCCGGGCCTGCCAGACATTCTCAGTTGATGCTCTTCGCACACTGAATAAGCATGCTCAATGTCGTCAAAGC
AAAGAAGTTCCACTAAGTCCTCAAGTGGGTAGATCTGGCTGCGATAAGCTCGATTCATTCGAAGCAGTGCCGAAGACCGCACGTTCGGGATATACCGGAA
GAGTAAACATGATTGCAGGTAGGTTGCTTGGCGAAGCAGCGAGAAAAACTGGAAGTAGTCACCAGTATGGCGAGCGACAAACACACGCATCGCGAACTTG
ATGTGGGGGCTTTCCAAAATATGACGCGGGAGATCTTTCACATACTTTAACACATCCATTCCACGGCCATTGTCCAGCGTACAGAGGATGAAATATGCGC
GGCATTCCGCCTCAAACGGGCTCAAGTACGCAGGATCTCCCACCTTCTGGCTTTCATCATACAGTTCattcagcgacttgagagtttgtccaagctgctc
caTATTTTGCTGAGCAACAAAGCTGGGAGTCTCAATGAGTTCGTGCTCGCTGAGAACGTGATATCGTGCAATACGTTCGTGAATGTCAAGTGCAATTGGG
TGTACAcgacctccagctccacgataATTCTGCAGTACGAAGTCTTTGCGAATCATCCGAAATCGGTCCCAACAGAAGTTATAAAGCTCGATTGGCTCTG
GAACTCGAGGTGTCATGAAACGTGGATCCAATCCACATTGATCCAGATCCATGATGGCCTGCTCGATATAAAGCTGCGTGCGCCGAAGCACGCCGGGAGG
GCGGATTTCCTCCGGAATATCTAGCTTGTGATCAGCTGAACTACGCTGGAAACGTTTGATAATCATATCGCGCTCAGTTCCTGGTCGATCAGGGAAGCAT
TTCTCGAAGACGCTCAGTTCATCCACCCGAATATGTAGCTCCCGTTCCGCTGGACTGCACATATCAGCGCACAATCCGTCCAGATTAATCGCTGCTGATA
GCTCAgccttgctgctctcgtctcGAGCCGAAGAGGCCGCGGACGGCATGGGAACAAACGGAGCCTCATCATCGCTTCCACTCGGCGCTTTTTTCTTTGG
TCGAGCTTGTCGATGCTTGCCTTGCTTTTCACCTGTTGGGCTAGTTTTCGGCGTCTTCGCAGCCCCAAAAGCGTCTCCATTAGCAGGGGGAACTTTTTGG
CTTTTAGTCATGGGCTGGTGCCCACCGAAGGGATTCGCGTCGTGCTCTGTCGAGGCGCCAAACCCTTGAGCGCGTTTGCCTCGACCAGATGGTGATTTTC
TCGTGCCACTCATTCGTGCCTCCATTGATGCCATCTTGTCCGCGTTCGCAAAACCACTTGCAGTAGCACCCGAGCCAAACTTTGGGGCAGACTGCGTGGC
TGCACCAAATGTCGTGGTTGCACCAGAAGAAGGCTCACCAAACGCAGAGGTATTACCACCCGCTGCTCCGCCAAATGTCGTGTGGGCGTTtgaagcacca
ccaccactagCTGATGCGGTGAAAGGGTTGTCTGCACGGGTAGCACTTGCCGCATTCGGGGTgatttgcttcttcttcactctTACATTGGACGACTGCC
CTCCAAATGACGTACCCGGTGCTGACAACGGTGCTGGAGCCGTACTCCCAGACCCAAACCCGTTCGAATCTTGCGAGAACGACCCCTGCACGCGCTTCGG
ATTGGGCCCACCGAAGGTCGTCTGTCCTCCACCGAATCCATTGTCGTTACTACCAAACGCTGCACTTCCTCCGCTAAAAGATGTCGATCCATTACCCCCA
AATGAAGTCTTTGGCGCATTTCCACTTCCTCGCTTCCCTCCAGCACTCGACGCAGATCCAAACGTCGTGTGAACTCCTGCcgacgtcgaagccgaacCAC
CATTCTGTCCAAACGATGTCGCTCCAAACGCCGTATTCGAGTTTCCCTGTGtcctgttgttgttgtttttgctgttttTCTTCTGTCCAAAAGGATTTCC
AcctgttgaagctgcaccaaATCCACCGGAAGGCAGCGGAGGTGCTCCAGCTAAACCTCCAGGAGGCAACGGGGGCTGGTTGCCAAAAGAACCTCCTGGA
GCGCCAGCCATACCTCCCGGAGGGAGCGGAGGCTGGTTACCGAAGCCAGAGCTCTGTCCGAACGTCGTTTTCACAGCTGGAGCGTTGGAATTGGACGACT
GGAAAGGGTTCACTGCAGCTGTCGATCCTGGACACGCCAAGGGACCATCGATCAATACCTAGAGACGCGTAGTCAAGTCCTAGAGCCTGCAGAACGAGCA
CGCCCAGAGCCAAAGAGTAACTGTAACCCGTGTAACCTTTCCGTACCTTGATTCTGTCCGAACGGGTTGCTATTCTGCGCCCCGAAGCCTCCAAAGCCGC
CGCCTCGATCTGCAGATAATGGCACAAAATGTATCAGCACGTAACTCGACAGCCACGCGGCTGAtcgcagcgcaagaagctggagaagataGAAGAAGCA
TTGGAGAACGCACTGCCGGAGCTAAACATCGCGAATGACCGTCCAGAGAGCTGCTGTCCACGCCTCCGGAGACGGTGTTCGTCCTCCTCTCGGGCCAGGT
CACCTTTTGAGGCTAAAGCTAACTGTACCCCCTCGAAATGGTACACTGTACCGATCCTCTCCTCTAACTTAATGTGCGCCACCTTATCTTTGTATTTGTC
CTAAATTAGGGTACCTCCtgcgctgtgattggctgtGTCTGTTGGGTATAGTGAGGCCAAGTCATTTCGAGGACTGGAGCCCCTTGCGCGTTGGGGAACC
ACCAATTCTCTGGCCGCTGGCTCCGCTTACACTTAGTTCCAAATTGCCCGCAACTTTCTGAACGTAGGTAAATGCTCGCGTGTGCTGCCCATGACGACAC
GGCCATGGATCCTCACCCCCCTGCCTCGCCCTCTATGTCCTTCTCTGCAGGTGAAAGATGGTGAAGCACAACAACGTCATCCCCAACGGCCACTTCCACA
AGTACTGGGAGTCCCGAATCAAGACTTGGTTCGACCAGGTAAGCCCACACACTCTctctaccagcagcaacactaCAGCCCAGCAgtagaagcagcagcc
agcaacGTAGAACACACGTCTACACTATTGCTCTACCACTGGGAGAGATACCGCGGAAGGACAAATCGAACAGGCCAATCTACGGAGCGTGGAGATATCG
CTTCGTTTAGGACCGACAGGACGGaaaaggagcagaagaacagGACGTGTGCTCGATTGCTagctggctgctggctggGAGTAGTAGGCTGAATCAGGTT
CTCTTGAGCAACGTACTGATTCTCCCCAATGTGACGACAACAGgcctcgaagaagaagacccgTCGTCTGAGACGTAAGGCCAaggctgctgccatcgcc
cCGCGTCCGGCCGCTGGTCTGCTGCGCCCCGCTGTGCACTGCCCCACGATCAAGTACGGCTCGAAGGTGCGTGCCGGCAAGGGCTtcacgctggaggagc
tgaaggaggctgGCATCAACCGCAAGCAGGCCATCAGCATCGGCATCGCCGTGGACTTCCGCCGCACCAACAAGTCggtcgagtcgctgcaggcCAACGT
GCACCGCCTCAAGGCCTACAAGGCCAAGCTCGTGGTGTTCCCGCGCAAGAGCAACAAGCCCAAGAACGGCGACGCCCCAGCcgaggagaccaagaacgcC
GTGCAGCACACCGGCCCGATCCTCCCCATCACGCGCTCGAGCATCAAGTCGACCACGGCTGTGATCACGCccgagatgaaggagaagagcgtCTTCACGC
AGCTGCGTGTGGCCCGCGCCGACAAGCGCATCTTCGGCAAGCAGGCCAAGCGTCTggcggacaagaaggccgagaagaagtaAGTGTCGCTCGCGCCGac
acgtgctgctggcctgATCTCTTGACCGACTCGTTGTCGAAAGTGACGGCTCTCTTGTCTAAGGTCTTTTGCGGAAAATTGGAACACAATACATCGCGCA
TCAAAAacaatgtcgtcgtctttgGGGTTTCCTAGTGCATTGGAATGGTAGTGATCATGTCGATGATGATAGACTTCAAGTAGTATGTTCATCGTCACTT
TAATCTCTGGTGTTGTGACTTCTACTACGTAGTAGCTTTGTCTTACACTCTCACGTCTGCATGCACTTCCGGGTCTAAGAGCAATGGCTGCTTCTCTGGC
TCGTCTGGTACCATCGAGATGGACTTCAGCTTGACTCGCCGTCCTCCAACGCTGGTGTTTTCTGACGTGTCCACTTTCTCGGGCAGCACACATAGGAATG
CCAGCACAAGCAACTGGCCGAAAGACGAGATCATCACGACCAGCCAGAGACGACTCCAGTCCACAACTTTCGTAATCGGGTCAGGCACGATAcccagcac
cgacaccacGAAAGAAGTTAGGATTCCAGACACAACGCCGCCGAAGTCCATGAAGGAAAGAAACAGCGCGTACGTCAGTCCTTGAACGTCCTGATTCGCG
GGGCAATAGTACGTGGCCACAAcgagcaactgcagcagtgcgaACTCGGACGTGAAGGCCGTGATGAACGACTCAGCCGTGCTAAACGTGCATACAGACA
CCGGCAGATCGATGATAGGCGGAGCCAACAACAATCTCGGGAGACCAGCAGCCACAGAGCACACTGtcgagagcaagaagacgctTCGGACGCTCTTGTT
GGTACACCACTTGGCATAGGCCAGACACGAGAGGAAGCGTCCAACCATTCCAGCCAACATCATGTACTGCAGGCACTCGTGCTCGTCTTGCAGGAGCGCG
AACGTGTACTGGTACCAGATCATCCCGTCGTTCGGTAGTGCATTGCACAAAAAAAAGAAGAGCATGGGCGGGAGTACAGGCTTCATGAGCTCCTTTTTGT
GGTGCAGATCTCGCTTAAACGGAAGCCACCACGACTTCAACGTGTTCCTCCACGAGGGCGAGGGCACCATCCCACCTACAATaactcgttcttcttcact
gcctCGAAGCTCATACACCGGCGTCTCGTTTAACCCAAAAAGACAGACAACCGCTGCAGTGAGTGGCAAAATACTCGTCCATCCGATGACCTGCTGCGGC
TTGATACTCTTGTCTTGATACACTGGGATCCCCAGCACCAACGCCGCAATAGACGCAGTATTCTTCACGCCATTGGCCGATGACTGCACGTGAGCGCTGC
TTCTACTTGTAGCGTCGCCCGTCGTTAGGTTCACTAGAAAAATACCGAGCATCAGTTGCGCAAAAGCTTCGGCCACTGAGTCCACGAGCTTGACAGCAAA
TGCGCCGGCAATGGAGTGAACGTAAGTGGCTGTGAGAATTAACGACGCGGCTGCAATGCATTCGCACAGGACGATGTACGACTTGCGCCGGTAGCCGAAG
AGCGGCAAACTGTCGGACAGCAGTCCGTACAGAGGCTTGAGGTTCCACGGGAAGAACGTGACCGAGTAGTagagcgtcgtcgtcgctggagccaTGTGCA
GATCGTCGAACAGCCACGCGCCGTACGCAATCGTGGGGAACGTCATGAAGAACGCGTGCAGGAAAtacagcgccagcagcgccaacggcACCCGTGTCGG
CGTCATTAGCGTCAGTATTGGCCTCAGGTCTCTGATGTGCATCTGATTCTGATGAAGACACATTACcacgagatggctacatatGTATCCGACGGCATTT
TGATTGGCGAGGAGGAATATTGATCCgtgattggatgaaaatGTGCGGTTGCAATTAGCTTGTTGTATCAATTAATTGCCTGGCGGAGGACGCTCGTAGC
AAGTCATGGCGCGCGACGAGTTCAATATCGACGAAGCCGAGGACTTTGACGACGGCACACGCGCTGTACTGCACGACGACAATGCGTCTGATTCTGATGT
AGAAGCGCAGGACTCGACGCGTCTGCGCTCGTCCCGTaagcagcgcctgcaggCCCAAAGGAGCAAAGGAGGCAAGCAACGAGAACAAGCGTCCGCTCTG
CGCGTCAAGAACTGGGACGCGGGGTTGATGGAGAGCGAGGAATACGCGGGCAAAGTGGTGAAGCGCAAAGATCTGACGGAGGACGGAATGGAGTCGCCGG
ATGAGGACGCGATGGCCCAGTGGTCGGATGCAGAGCCGTTCGGAgcctcggacgacgaagaaggagaggacgaggagaagggtgaagaagatgaagaaag
tgaagaggagagtgaagaagatgatgaagaagataaGGGTGCGGAAATGCTCAtccgcagcttccagaaGGAGGACTCGGCCCGGCTTATGGGCGCTCAG
GACAGTGAAaaggtcgtggagaaggcgagGCATGTGAGACATCAGAAGGTCGTCTGGGAACGTTGTCTCGAGGTGCAGATTTACACCAAACGGctattga
cgacgacgaaggaggcTGTAGCTCATGAGACGGATGGAGAGACGGATGAAGAATCAGCTacaaagaagaaggaggaagtTGTTGCAGAGTTGTACAAGAG
CATTGAGGCTGTGTCGGCGTTGCAGGAGAAATTGTGCAATGTTCCGGAGCTGAGTGCTGGTGATGCTACAAAGAAGCGTAAACGTGCTTGTGACGAGTTG
TGGCAGGAGATTACGTCGAGTAATCGTGCGATGCTGCCGCAGTACAATGAGATTCTCAACACATACACGCGCAAGACGGACCTGGCGGCAGGAGGAAAGA
ACAACCAAGCGAAGAAGTTCAAGGCTGTGAACCAAGACATCCTGGCACAGGTGgagtcggtgctggtggatcCTCAGCGAGTGAAGCGGAAGGCACATGC
TCCGTTGGATGTTCCGGAGGCTAATGCAgcggaaggagctgaagatcTGCTGGATGAGCTCATGTATGACGACTCGGACTTCTATCAacagctgctgaag
gagtttATTGAAagtggcggaggtggcgctggccaggACGCCATGGTGAGACGCACGcaccgcaagaagaagaaaatcgTCAACCGCAAGGCCAGCAAGG
GCCGCCAACTGCGCTACACGGTGCACCCCAAGCTCGAGAATTTCATGTTCCCCGAGCCTTACCCGAAGCCGGAGATGGATACGGACGAGCTCTTTCGCTC
GCTCTTCGGCCAGGTTCGGCAGTAGGCAGCTCGATATTGCCATGCCGAAGAATAGATTGATTTTGATGATAAAGTGTTGATTTTGTTAGCATGCCATGCC
TCCTTCTACTTTAATGCAGAAGATGTAACGCGCAAGATCCCTCCTTCCTTTGCCAAAGCATCCGTTTTCCTTAAAGCacatcgtcctcttcttcctcttc
ctttTCACCTGATAGGTACATCTCCTTGATCTTTGCTAGGTTTGCTTCCACTTCCCGTAGACGCATTTCATTGACTCCGTTTGCGCCAATCTTTTTTACT
ATGCCCACCAACGTGACAGCCTTCTCAGCACAATGCACTACGGCCAACGCTCGGATTTTCTTGGCTCGTGTTGCATTCTCCAGCGATCTGAACTCTTCTT
CTGCCAAGTCCATCGAAGCATCAGCAAGTACCGTCGTGCAGTCGATCAGCGCAGTGCCACGTTCCTCAAAGCGCTCAGGGATGTTGAACGTGTGCAGTTG
TCGCACTTCCGCCGCGTACGAACCGCTCTTAAATACTTTGTGTTTGAGCTTCACCGTGTCCTTCAATAGCTGCGTGAACTTGTCGATTAATTCAGGTTTT
CCCTTGGCCATCGCGCGCATAGTTGCAGGGGCGTTGATAATCTGTGCACGCTTTGCGATCAACTGACCGGCATCACGTTCTAAGAACGAAAGACCCCACA
GTCGACCGTACGCCTTACCAGCGTCCAATCGTTCTTGGTCGGAGAAGTACCAGTCACGTgtgtccttgttcttgataAGCAGGCGCGAGGACCAAGTCTG
AACCGAGTCAGTTCCAAGAGCAAGTCCATATTCCTCGAGCTTGGGGGCTATTGTCTTGCAGAAGACAATTGCCTCTTCGTCCGTAGACAACTTCGTCGCC
AGAAGCTCTGTCACCAAGCGATTTACCTCCTCGCGATTCTCCACAAGCTTTTTATTGCTCTCCTTTCGTGCTTTCttttcaagctgctcgatcAAACTCA
TACCGCCAGGACCCTTCGACTGCTGAGATTCGTCGCCAAATATGTCATCGATAGCGCTttccgcagcagccagctcTTGAGCCATTCGATCTTCTACAGA
TCGCGTTGGCATTCCATCCACTACACCACTGCTgcctccacgaccacgtACACCAGTTGATATACCTCCACCGTTCGAGACTGTATTGGGCACGAATAAA
CAGCATTCACAACTGATCAGTACAGTGTCACACACATGTGAGTATATACGAACTCACCTTGCTGAATGATCTGTTGGTGTTGCATGAGAATGCTGAAGAG
CTGTTCCATTGAGACGGGGCCGGTAGGGGAGGCAGGAGCTTGAGCAGGAGGCTAGTTGAAGCACAACCGTCAAAGTCAGTAAAGCTTAGCAAGTTCCAGT
CAACCCGAGAGAATGATTTAAGACGTACACCAGGGTCGTTCGGAGATACGCCATCAGGATGATCAAGCAGGTCCGGATCCACGTCCTCTGCTTTCATCTT
TAACTTTATCTGCTCGTCAGGCATGCCCATTTGCCGCAGCTTGAAATACTTCTGGAATTTCGGGTCATCTTTCACATGAAGTGGGTCGTACGGAACGACA
GGGGCTGCAGCGGGCATTGAAGGCCAGCTAAAGCCCCCGTTTGCACCTTGCAGTGGAGACAACGGTGGCATTCCGTTTGACTGATACCCTGCGGAGATTC
GCACCGGTGGCTATACCACAGGATCAAGCACAAACAGTCAGATCATAAACACTCGAGAAGCAAATACCATTGTAAACGTACGCCAGGGTCATTCGGTGAC
ACCTTGTTCGGGGTGTCTAGTAGCGCGGCATCTACGCCGTCagcctccatcttcatcttgatctGATCAAGTGGCATCTCCAtgctcttcaacttgaagt
aCTTCGTGAACGCAGGATCGTTCGCCACGGTCATCGGGATGTACGCGCCCTTCTCGGGCTGTCAACAACCACAAAACACCTCATGAGTCACTAAACCAGT
CAGCGAACCAAGTAACTCAAACTTACACCAGGGTCGTTCGGAGACGTTGCATCCGGCGTGTCCAACAAATCAGGACTAACTCCAtccgccttcatcttcg
ctttGATCTGGTCAATGGGCATTTCCATgttcttcaacttgaagtaTTTCTTAAACTCCGGGTCGTCTCTCACCAATAATGGCGTGTAGATACTCGTGGC
AACAGGCATCATGCCTCCTGACTGCGACGCATAGGCGACAGTCTGCGTTTTCTTCTCCAACTCAATCAACTTCTCCTGGAGTGCCTTAATATCCTTCAAA
TTGGCACCAGAAGATCCTCGTTCCCTGGTCGTCATTCCATTCTTCTGTTCTGCCATAAGTTGGGCGATTTgtttctgcagcttgtcaatAGACGAACTGG
TGGTCATAGCGTCTGATTTCGTCGCCAAATCCAGCAATTTCTTGATCTGAATTGGCGTCAGGCCAGGGACAGCGattcctcctgctgctccacctcctcg
tcctgctgctaACGGGGCGTGTGCCACATCTTCACTCTCCGagtcgctttcgtcgctctcgtcttcggattcttcttcttcctcttgttcgGCCGCTTCT
CTCTCCATCCTCAGCTTAATGCAAAGGTTGCGGTGGGCGTGGGCATGTCTTCTCTTGCAGGTCTACAATACCATAGTCATAAAAAGTAATTACGTTCTTA
GTTAGTTAGTTTTTCTTTTCTTATTTCTTATTCTTGTCTAAAATGATGACGTACTTCGCTGCAGTACATGGCCTTGTTGCACATGGTGCAGAGTAACGAG
GCGTTGGGCGTCGCACAGTAGGCGCAGTCCTCGCCCGAGGCGAGCGAGAAGCCCGAGCCCATGCTCGTGAGGCGGCTCAGCAGctcatcttcgctgtcgc
tgtccgccatggaggaggtgatTGACGccgacgcttcttcttggggtcTGAGCTTTCTAACGGCCGTTTCTCATGTTGAATCGGGACCAAAAATAGATAG
CCGTTCCAGAAACAGGTCCCACCTTCGAAATATCGACAGAAATAGGCTGCTTGGATATTTGGCGCTGATGGCCATGGACCACCTTACAGCACGACGGAAA
GCCCGTGGAATCATCCTCCCCATTCCTGCCAGTCAACGAGCTTGTCCACAATTTTTGCAGACCACAAGTCTAACGACTGCGACGATCCTGATGCTCTTGT
TGCATCCTTTGGATATGCTTGCAACAGCAGTTTTCCCACTGGATAAGATCCTGGTCGTCGGTTgcggccacttcaacttacaGACAAGACCaaagtgatg
atgaagatgaaaaAGCTTTGTGAATTGATGCTTGCTCTGCTACAGTACCAATAGGAATAAATATCGTAGCAGGCGgccatgttgctgcgttcTTCGATCG
AACACAGttggccgctgctgcttatAAAGATAGGGGGTTGCCAATAAACAGGAGAACTGCACTTCGTTCTCCTCTTTAGGCTGCGGCACGGGACAGTCGA
CGATGCGAAAGCATGCGCACCATGTCGGGCGACTTGTCGGTCTCGCTGATGTTGGGCAGGTAGTCCGATCCCATTTGGTCGCTCGAAACAATGCCCGAGA
ACCGCTGGAACAACTCGCAGATGGTGGCGTGGCCGTTGGCCTCCGCGATCATcatggcgtcgctgtcgttcttGGTGCGCTTCTCTGGgtcggcgtcgtg
gcgcagcaagaactccACTGCGGCTAACGAGCCCAGTTTGGCGGCGAAATGCAGTGGCGTGATGCCACTAGCGGTCATAACATTCACGTTGGCGCCGTGC
TCCACGAGTAGCGACACGATCTCGAGAGACTCTCGAGAATTTCTCTCGGGGTTTTGAGACTGACTCACGATGGCGGCGTGGAGTGGATAAGTGCCCCGGT
TGCTGCAAACCGAGACCTTGGCATTGGCgtcaagcagaagcttcaCGACTTCGACGCATCCGTTCCGGCAGGCTGCAATGAGTGGAGTAACACCGGCTTC
GTTCGCCTTGTTCACGTCCGCTCCTTCCTCGAGTAGCAGAGCCACAATGTCGGTCCGTCCCATGCGGGCCGCAATGTGTAGACACGAAGAACCATCCGCC
ATGGCCGTGTTGGCATCAGCGTAGTTGAACAGGATGAGTTGAACTGCGTACGTGTGGCCGATACGGCACGCCACGTACAGGCAGATCTCCCAGCGGCGCG
TCTGTGTGAGGTCGGGCGAGTTTACTTCATCAATGTCGCTCGCGAACTGACTCAGCACGTGCTCACAGAACTCCTCCATGAACGAGTGCATGGTGTGGAC
ACGCACAGTCTTGACCTGtagcgacggcagcgtcacgctcTCGGGTTCTGGATCCTCCTCTTGATTTGATGAAGGCGCCAGGTCCTCTGCAATTCGAGGC
TCGACCGCACGTGGGGTGTTAAGGTGGACTTCACTGATCTCCGAGAAACTGTTCCTGAATccaccgtcgtcttcctcttcatcttgcccCAGCATCTGAT
CAGCGCATTGTTGTCTCCAGGCATTCAGCGCTAACGGACGATGCAAGTCCACCGACGTATCTATCGGGAAGTGCTCTGCAGCACCCAGGAAGTTGGCGTA
CGTCTTGAGCACCAAACAGCTGCCGCTCTGCAGTTTCTCGCGTAATGTCGTGCTCGCGAAAGTGCTGAAGAATTCATGTAAAAGCGTCGCAAAAGCTGCA
AGGGCATCGCGACGTTCGTTGACAGCGGAGTGGTCGAGACCTGTAAGCTTCGAGCGGAGCGACCGTCGAGACGGGAACGGGAACGTCTGCAGCATCGGGT
ACAGCGCGTCGAACTCGCAGCGGTCGTCAGCGCAGTGGCATGTGTGCGTCAAACCGAAGTGGAGTCGACGTCCGTTCGGTTCGTTCACGCGCTCTTTGAG
CGTCTTCCAGAGGCGTCGAAACTGCGAGTACGAGCGCAAGGTAGTGCAAATGCCAtcaagcgacgacgacgtgggcACTTGAGCGCGTGCATCGTTCTTG
GTGAGTttgatggcgaagaagacctTGCCGTCGGTCACTTGGTACGAGGGCACAGCCACGTCGTACTTGTCGATCCAGCTCatgcgtcttcttccgctcT
CTTGGGCGAGTGGTTGGTTGGTTTGctggctgcttcttcgctaTGGGAGGTGGGTGAGTGGCGTCCGTGCCAGCCTTTCGACAATCGGAAGAGCGAGATA
TCTCCGCCGAGGATGAACAGGCTCGAAATAGGTACCGCACCGAAAGACAGGCTGGTTTGGTAAATATAAGTCGGTACGAGTCCgctgcaagcagcacgac
tGCGTGGATCTTCCTCCGCGGGGAAAATGGAGATTGGCGCTGTGGCAGCCGGAACCCCCAGCAGGCCATGATGCGCTGTGAACTCGCGACCATCGTCGTA
ATGCGCTCGATGTCACACCCCTTCAACTGCGACCTAATCTGCCAATCGCGTGTCGTCAACTCCGTATAAATCCGCGTTTTGGCCAATCATCGCGCGGTCC
CCCCTGTTCACAATCGGACGCAAAAAATACGCAGCGAAATTGCTCCGGCTCTGTCGAAGCGATATCTGGCTCAGAGTCGTCCACGGCGGTCTCCCGATGT
TACTGCGCTCGGAGCTCTGATCCTTGGTGCAGTGTTATCGCCAGCAATGGCATTGATATCTTAGCATGGAACGACGTGTGCAATGAAATGGATCTGGAAC
GTGGCTAATCTATTAAGCGGCACTGGGCTGTCCAGCCAcaacgaagttgaagtgataAGAGCCCCACACTCGCGACGGCCCCGGTGGTGATTTTCTCCCG
ACGCGTACGAGGCCACACCCCTGAGAGGAACGTACACTTTGAAGCAGATTGCGTGGGGAAGGTGAACAGATCGACGTTAGCAACCTTATCGGTCAATTTT
CCATTTTTCGATGCGGCTCCGAATCGCAGCTCGATCGATGACAGCCGATGGATTTTCGCAGCGTCCAACTCACGGGCTTTGCTCCAGTTGGCCAGCGTGT
CAACGTGCAGTCAGCCGTGTTGAACCCCCAAGGTCAGTGCAGTTGAGGCCGCAGATCCAGTGGAGAGGCGAGCAAGTCTGTCCGCTGCACCACGTTCAAC
TCCGACGCTGTGAATTGATCCTGCAGTAATTGCAATGGatcgaacttcttctcgatgcGATGCTGGCGGTGAGCACCCCACGGGTGATCGCAATTGCAGA
CCCACGGACTAATGGGAAAAAACGCAGATCAAATCGTTAGTGATGGATTTTCAATGAACAACAATCCCAAAAATTGGATCGGTCTACGCACCTGTCGAAT
CCTTGACAGCTACAGTTAGCCTTTTTGCAAGCGAACGGTTTGTTGCTTGGGTCGTGATCCGTGTGTCTATGTTTGCAGCGGCATCGTAGGATCCAGGCGC
CCTCCGCCACAACGTAGAAGAAGGCTTTGCACGAACACTTGGCTGAAGTGCACGCAAAGGCGCGGAACCCGGCGGGGGATTTCACGCGAGGATCATCGAC
GCCGCTTGGGTGCTCCTTGTATCGATGACCACTGCATTGTAAAAGTTGGAACATCCGTTAGTTTCCAGGATTTGTTCGTCCTTTCAGTAAAGTACCAAAC
ATTACCACAGACATCGGCTCTCCTCGCGAATGGGGATACACTCGCGCTTGCATATGTCACATGACCATTGAATCACCATTTTCGTGTagctcttcagctt
catcggGAAAGGGGCTGGAGTGGCTGCTGAAAGCGCGACAAGGGCAGTGGGTTGGCGTATGGTTGGTAATGTTGAGTTTCGGTTCAGGTCTGAGAACTCT
CGCCTCAATGCTGTCGCTGAAATCTCGTCTGCCTGGTTGCAACTTGCTGGAGTAGTTGAAGTATCCGCAGCTGGTGGCTTGGTATCTTCAGACGTGATCA
CAAGCGATGGCTGGCTCAGCTGCACTGCACGTATACCTTGCTCACGGCATTCAGCACCGAAACccgcgacttcttcttgttgatttGTTGTCAAGTCTTC
CATTGCCGCTGTTATGTGGTGGGTTGACTTGAATCGCCGCCTACCACTTGCTTGCAGCTTTCTCTTCAGTAGTTGCAAGGACTGGGTCCGTGTATTTGTC
TCCATGACCACGGTCTTGTCTTGAGCGTCTCTTCAAGTGCTCGTTTTTAGTTTTGGGATCTGGTAGCAATGACGAGATCGATTGTAGTATTCTGTGTCGT
TGCTACGACTGCCGTGATCTCCACAACCGAAGCGGTCGGTTGCAATGCTGGATCGTACTTTGATGGTGTCCAGTGTTCACCTTGTCCAGGAGGTACATTT
GGTGCCATGCCAGGTCTCACGTCCCCATCGTGCTCCGGTTTGTGCTCTGCTGGGTTCTTCTGCCCGGAAGGATCGACCTCATCTCGAGCAGAGTCCTGCG
GCCCACCCATCTACTATTGCCCACAAGGTAGTGCTGATCGTCGCCGTGTAGACATCGGATACTACACCATCACGTTTCCAACCGATCAAAGTAGGTTATC
TATGGACGACAGTTCGATAGGCGGTGCTCGACAGCAAAATCGCTGCGAGAAGGGATACTACTGCGTCTTTGGAATCCGGCGAGTCTGTCCTGCAGGTGTA
TTCGGTGATTCGACGAGGGTCACTACTCCAGCTTGCTCCGATCTCTGTCCGAAAGGATCTTACTGTCCCGAGGCCACAAATGTACCCATTCCGTGTGCTG
CTGGGACGTTCGGCGGAGAACTTGGTCTAACAAATGTTCAATGCAGCGGGCTCTGTCCGATCGGATTCTACTGGTACGTCCAAAATGGCTATAGCTGGTC
ATTGTATCCATACCTGCACCATTGACGCCATTCACTGCAGTCCACTCGGGACGGTCACTCCGATACCATGTCCAGCAGGAACGTATAGCGCGACACCAGG
CTCGGTCAGTTCAGCTTGCTCAAGTTCGTGTACTTTGGTCAACGGTGTACTTTCGTACCTTCCATCACCTTGTCCGTCAGGATTATACTGCCCATTGGGA
GCAATAGTgccgcttgagtgcggaAATGCAGGTGTATTCTGCCCGCGAGGTTCGTCCGCACCAACGACTGCTACAACAGGCTACTACACCACTTGGAATG
CGTCCACGGGGCCATCCATGACAGCAGagcaggtggcgctgctATACGTTGACGGCAATCTTCTTGCTGTCCGGAACCAAACCACTCGATCAGATCAACA
CATTTGCGAGAAAGGCTCGTACTGCGTCGGCGGTGTCAAAAGACTTTGTCCAGGTGGTACTTACGGCGCATCCGCAGGCTTGTCGACTGCATCATGCACA
GCACCATGTCCCGCCGGCTATTACTGGTAGGTGAATCGATCTCACCATGTCACCAACTCACCAATTGACTTTCCCAATTGTTATGCTTCTAGTTCGAACG
GAACTGCAGACTACACCCTGACTCCGTGTACATCACAAACATCATTTTGTCGCCAAAGCTCTTCCATACCAACTCCCGTTGACACCGGATACTTCACCGT
CACGACACAAGCAGGATTTCGCTCGAACGAAACTATTTGCCCACGTGGAAGCTTTTGCATTGGCGGCGTCCAATACCTTTGTCCCAATGGTACGTACGGA
GCCACTCCTGGTCTCGCTTCCAACGACTGTTCCGGTAAATGTCAAGATGGATATGTGTGTCGACGTGGCTCAACTTCGGTAAAGCAATCGCCTTGCTCAG
CGGGAACGTATTCACAAAATGGTATATACTGCTCGCCTTGTTCTCCCGGATACTGGTGCAGCGTCGCGTCTCCAGATCCCCAGCAGAACCCCTGTGGTGC
TGACAATATGTACTGCCCGCTTGGTTCATCAGCTGCCCAGCCAGTGCTCGATGGTTACTACGCTGTGGGGCAACAGGTCAATACACACACCTCGCAGGCG
TTGTGCGTACTTCGAAATGCCCCTCACCTCCCCCAGTGTCCTTCAAGAACGGTTGGTGTGAACGGTAACTTGTAACACGACACATTGCAAACCCTTACCT
TTATTGGCGACACAA