Description :
From Genome Similarity Track
Location :
Scaffold_1466:230- 1886
Transcript NameFunction/comments
Phyta_totarag13050conserved hypothetical protein
Phyta_totarag13051eukaryotic initiation factor 4A-III, putative

Sequence
1656 bases(100 bases per row)
TCGCATGGCGTGGTGATGTCACAAATCTCGTCTCAGGTGACACAACGAGCGAAACATGCGGAATGAAACTACTCGCGTCGTACGTGCGCTATAGTGGAGA
CCTCGAACGCCTGAATAGATCATGTGTAGATTTGGTGCCAGAACTCAATCTGACGGTGCCGTTCTACTATAAGCACACTCTCTTCGGCTCGGACGACGCG
TACGGCGGAGAGTACAGCTCGAGCTTGCTCAACTACGTTTAGACTGTagcttcaacatcaacgTGTCACTATGTTGAGGGAGGAAACTGATGAAGTTAAT
GACATGCGTGTcaaaaaaaaagaagatCTTTTGGGCCAAGAGGTGTTGTCCATGAACATGCCGGTTCTGCCTCGCTTGGTGCTGCGTTGTTTGCCCCTCT
ACATCATTGCAATCTTCTGTGGCATTAACGACCACAATACAGTCGCTTCCATCGCGCCCCGTTTGTACTTTTCCAATGTTCGCACCCCCCAATCTCCAAT
AGACCCCGTCATCGCCGACGCTGCCAATGTATCAACACTTGTGCAATGCACACTACGCTCTACAGTACGTCGGTGGTACAACGCTTTATAACGTTATTCC
AATTGTTATGTGCGTGGTGGCAGTTTGCAATGGACCAGCTTCGAGCGTTGTCGGACTCGGGCATCTacacgacgctgtcgcttgcCAAGatccacgcagc
agctacggAGGTGCAACACGAACTGTCTCGACTGCATTGAGAAAGGTGGTTGTGTCTGCGGCTTGGCTAATGCGTACCTACCTATTGTTTGCTGTGTGAA
TTACAGCTGGGAGATTTCCACTATGTGATTCACTTGCAGgtggcgttggcgtcgccGTACTTTCGGAGCAAACAAGACCAGGAGGAATTTGAgatgatgg
tgctggagagcaaGCCACGAGTCGAAGAACGTGCCAGTGGCACATTTAATGCCACCAGGAGTATTGCGATCGACGAGTTCCCCAAGATGGATGAAGGTGC
AATTGAGACTTTCTGGGTGCagatggtggaggagaggcgtcgacgtcgtcgcgagCTGTTCGAGAGATGggagcgtgaagaagaacctGAGAGTGAAATC
GTCGAGTCTGCCGGTGTGGAGAACTTGGAGCAGACGGCGAAGGCTCCAgtcgagaaggtgaagaagacccTGACTATCGACGAGCTCCAACGTTTGCCTA
CGAAACAGCTTCGGCAGCTATTGGCCACGCCCGAGAGTACGGCGCCACTTCGCGCCGCCATTTCAGCCATTCTGGATGAGCGTCTTactcttcttgagca
gcgcgaagaagcCCTGTACGAGCAGaacaatcagcagcagcctgcaCCATTGAACCTCCACCGCGACGAACTGTGAGCTGCAACGAATTGAATTTTCGTT
TACGTGAACAGCGTAGCTGATGTATTCAAAGTGTTTAAAATCAAACGAGAACGACACGAGCGAGACTCATGCACAACTTAAATGAGATCTGCCACGTTCA
TGGGCATCTCATCGATCTGTGTGCTATAGTACTGTTCGATGTCTCGCAGAATGCggatgtcgtcgtccttgacgAAGTTGATAGCAACACCCTTGCGTCC
GAAACGGCCGGAACGACCGATGCGGTGAATATACAGCTCGCGATTGTTGGGCAGGT