Description :
From Genome Similarity Track
Location :
Scaffold_2071:230- 1455
Transcript NameFunction/comments
Phyag_g11997hypothetical protein
Phyag_g11998hypothetical protein PHYSODRAFT_450479
Phyag_g11999conserved hypothetical protein

Sequence
1225 bases(100 bases per row)
TTCTAGCCACTCAAGCCATTGCTTCTCGACGTCCGTGAGGTCTTCAGGACTTGACTTTAGTCGAGCGACCATGGCCTCAGCTGCTCCCCGCGGATACGCA
AGCTGCAGGCTAATGAAGTTGACAAGCCGCGCCTCGAACCTTCAGCCCCCGCAGACGTCGGCCGTATGGCTTTCTCAATAGACGGCCGCGCCAAAAGTGG
CGCGGCCATTTCGAGCCACGTGGTGGGACGTTGCAAGCGTCGTTTCACCTCGAGGATATGGCTTCGGTTCCTCCTAGCACCTCGGGCCAagctgccagcg
ctgccaTGGTCAAgcaggctgccgtcgggTTCCTGTCATCACCGCAAGCCTCCGACTATCTGCCATCCATCTCGCCCACCGTCGTCTACTCTACTGCCCA
AGCTGCGTGGACAccgcaggagctgcaggtgctgcaagCCGGTCTCACCCAGTTCCCCGCCGACCAATTCGACAACGTCACACGCTACATCAAAATCGCC
GCCATGCTGCCGCGGAAGTGCGTGCGCGACGTGGCCTTCAAGGTCAAAGCGCTCGGCTACCTGAGCggccagccagcagcagcagcaagtgccaCCAAGC
GCATGAAGATCGAGCCCTACCAGGATCCAAACAACCAGCCCCCATCATCGACCgccgagctggaagaggctCGTCTTgcggcactgctgcaggacaacgT
GCTGGCCATCAACACCATGCGCACGAACCTGCTGAACGGCAAAGCGGACGAGAACCGCGCGCAGATGCTCAAGTTCCGAGACAACTGCCAGACTGTGCTC
TCTGCGTACGTCCTCCATGTTGGGTTCTTGGTGCGTGTAGCTAACTCTCCCTCTGTCTTGATCTGCAGCCTGGGTGGCATTTGTACGTCCATTCCACCGC
TGCCACTACAACTCGACACGTCGCTGTTagaagaagacaacgacaccagcagcaacaatagCACCAAGAACCAGTAGGATACGAGGGGTGAAGTTTTCTT
GCTTGCTCACATACCTGGCTGGTAGCCTCCTTCGCCTCTTGCAGATGCACATACGAGCTCAAACTCGAGTAATCTATTTCATTGTCCTTGCACAGTGGGT
CCCTCCGTTAGCGTCTGCGACTGTGTCGATCCGAACGGCCAcgactgcggctgcgtcTATCGCGGTCTCGGTCTCGGTCACGACTTCTGTCTCGACCATT
GTCTCGGTCCCGATCACGCCCCCGA