Description :
From Genome Similarity Track
Location :
Scaffold_1320:230- 1233
Transcript NameFunction/comments
g16196.t1XP_009846822.1 hypothetical protein H257_19374 [Aphanomyces astaci

Sequence
1003 bases(100 bases per row)
TGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGGGCACGGTACTTGGTCTCGAACATTGTGACCAACCCGATTGACGAGGCGACAAAGGTCGT
CACGTTCATGAAAGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAA
GATTTTAGCCTTCGGCAGGCTAAACGGCATGTGAACGCCCCACGGCTAATGCCACGACCGGTGGTAAGGCCGTCGGGAGGTCTCGAACCAATGAACCTCT
CGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGTGCACAGC
ACCTGTGCACGCGGCGAAGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATAAAAAAAACTAGAGGGACCAGCAGGGCGCCCCGCGCCTGCTGGT
GATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACC
TTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGAGCATCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAG
GCTTGACTTCGAGGAAGTGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGGGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGC
TTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACAATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATG
ATCCGGTGATCGACTGGACGAAGCGCACGATCGTGTGCTTCAGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCGCG
TGG