Description :
From Genome Similarity Track
Location :
Scaffold_157:23- 5282
Transcript NameFunction/comments
Hyaar_Emoy2811425hypothetical protein

Sequence
5259 bases(100 bases per row)
TCACCGGAAGAAGCCCCGTACTGGTAGTACGGCCTAAGGCGACCGACGTAGAACGAAGGATTCGTGTGCATTTCACGTGGCAGTTCAATCGTATATACGT
TGCCTAGGCGGAGCAGCACACGAAATGGACCGATGAACTTGGGTAGTAACTTGTTACTTCCCACGTTAGTCACTATTTGTCGAGGTAGGTTTACCGTAGA
TATTAAGATCAAGACTCCTTTATTGAATAAAAGAACATTTGCCCTTCCACTCTTGTCAGCGTTTCATTTTTTCGATCTACCGCCTATGCGATAGAGTCTT
GTACGAAACGGAAAACCGTTTCGCGAGCCAGTATGAATTCATCTGACTCACTGTTTTTAGCTGCAGTGCTCTTGGAGCGTACTGTAGCAAGAGCACTTGT
CGCCTCTGTGAGTGTGTCTTTGGACGTACTAGGCGTGATGCTGATTTGATCAGTATCGTGGCCGGTAAGAGCATCTTCGCTCTTACTTTCGACTTCTTCA
CCAAAGACGATGTGATCGACATCGGCATCGAACGTGGTGACCTCATAGTCAGCACGTGAAGAGTAAGAGCCGGATTGGCGTTCACTCGAATGATTCCATC
CCCCTTCAAATAAGAGTCACACTCTAAAAGGTGGGAAGACGCGGATGGCATACGCAATTCACGAAGAAAGGCGGGTGCGTCGTTGACGCATGTACCGAGT
TGTCGCTAGCGAATTCTACCATCGGCAATAATTCGCTCCAATTTATACAGGAATCAACATATACTCGAAGGATCTCCTCGAGGACACAATTGTCGCGTTC
GGTCTGACCTATTTTAGGTTGGTCAGGTGTGGACATCTTTAAGTGCGTTCCAACTGTTTTGAACACGGAATGCCAGAACACGACTGTGAATCGCGCGCGT
TGGGCATACGCAAGTTAACGAGGCAGCCCATAAAGGCGAAAGACCGTGTCGATAAAGACACGAGCACAAGCCGATGCGTTGATTGATTCAGGTACAGCAA
CCAGATGTACCATCTTACTGAATCTGTCAACGATCACAAGAATACCAGTATTCTTGTGAGAGTCTGCGGGTAATCCGAAGACAAAGTCCATTGAAACGGA
ATCCCAGCACTCTACTGGGACGGGCAGAGGCTGCAACGGAGCACTAAAGGAAGGATAAGATTTCACCCGTTGGCAGACCTCACAGTCCCGAACGTACTTG
CGCACGAACTGATACTGGCGGGGCCAGTAAAATTCGCGGCTCACTGTGGGATATGTTTTTTCACGACCACGATGTACATTAACAGGTGCGTCGTGGTACT
CATACATGATATGCAATCGCAGATCACCATGATTGAGTAAGACGACACGAGGTGTGTCGCCGGCAACAGCCGAATATTGGAGTAAGCCGTTGCGAACTGT
ATATCTATCCGTAGAGGATCGATATACTGATGACGACTGTTTGAGGCTCTTTTCGGATGGGTGTGAGAGATGATGCATCAATCGCACCATTCCCGGATCA
TACGCCTTTTGTATGTCTTCCAATAAGGTTGACGACAGGAAACTCGAAGTCAGTACCTCGACAGTGGTCGGACTAGTGTCGGGTGCCGCAGCCGGATCGA
AATCGGGCCGGCGCGAGAGTGCGTCAGCGACGACGTTGAGTCGTACTGGCTTATACTCGACGAAGAATTTATAATTCGCAAAGAATGACAGCCACCTCGC
CATCCGCTGCGGGAGGTGTGGACTGTTTGCGGCCGTGTGCATGGCCGTAAAAACGATGAAGGGTCTATCACCTAGCAGATAGACTCTGAAATTAGCCAGC
GCGTACTTCATGGCAAGGAGTTCCTTGTCATGGACGGGGTAGTTGCGTTCAGCTGGTTGCAGCTGACGTGACTGGTGACACCTTCGAATGAGCTCTGGCA
GTCGACACTCCATTCCCACCTCTCGTTCTTTTTCAGTAAACGAGAGAGATGAACAGTCATCTCGGCGTAATTGCGTGAATATTTTGCAAATACGCCGCTA
GGCCAAGGAAATTTCTTAGTCCCTTTCCATCTGTAGGAACCGGCCAGTCGGTGATCGCCTTGAATCTTTTCTGGATCGGGCCGGACACCATGCTTGCCCA
CGATGCAACCAAGAAGTGATTTTCGCTAGCAGCAAATATAAACTTCTTGAGGTTGGCGTACAACTTATGCTCGCGCATTAGTGTAAGAACTTTTCGGACG
TGGAGTCGATGCACTTCCACATCCGTATGTCCATCCATAGCCCGGCTTTGGACGAACAAATCATCGAAGTAACTGTGAGCGAACTCTTTTATCGATCTTG
ATAAATTCGTTACACATCTGTCGAATGTGGTAGGAGCAATGCTTAATCCTGGTGGCAACACTAGCCACTCCCAGAGCATAACGCTGTGGTGCTCGCCGCT
TTATACGGGATGTACTTTTCGCGCCAAAGGATCTGATAGAATTTGTCCATCAGATCCATCGATGAAAAGATGGTACTCTTTGTCACACCATCGATGATGA
CATCTTTCCTTGGTATCGGCGTTCGAGCCAGTACAGTTGCAGCACTCAGCTTGTTGAAGGCGTGTACTATCCGCCACCCTCCTGAGGCCTTTCACGCATA
CGTAAGTATACATGATAGCACGCGTAGACATACAAATACCAAGTCACAGTGAGTGAAACTCCCGTGCATCATCGATATTCTGGATAAAAGGTAGACAGCA
CCCGGACTTCCCCGGTGGGAAGTCCGGGTGCTGTCGTCGACTCCCTCACATGACCGGCTGCTAAGCGATCTGCAAAGAATTTTTCGATCGCTAGTACTTG
TTCACGAGGCAGTGGACATTGCTTCACAACACAGTACTTCGAACCTGGTCTCACGTCGATTTCGTGACGAGTACCTTTGCCCTTAGGTAACTGGCACGGC
ACTGCTTCCGGGAATACATCCCTGAATTCTATCAAATCATCATAGAAAGGATTTGTTCAAAGCGATTCCCACGATTGGAATGTATATCGCTCAATCCGAG
TCTTTTCATCAAGGACAATCTCGTCCATTGATGATCTACTGATAATTCTTTCATCTTCGGCAAAGTCCATTGTTGATCGGATATCACTGACGTACTCATC
CTCCGCGACGAGTACGTAGATCTGCTTGACTTTGCCACTACGCAGATCACGCAACAACCTTTTTGGTTCAGCGGGGGTAACCGAGTGATCTCCAAAGTTA
ATTTAGGAGGCGCGATCAGATCAAGTATATGGATACCTATGCTTGATCCGTCATTAACCAGGACATTCAATGTCTCTGTCATCTCATGGGAACTTACTTC
CACTGTTTGTTTGGGGACTTATTCCCTCAACTCTAGCCTCTTGGGCTATTCCGTCTCCGTGTTGACCATCATTGGCAATCGGTTGGTCATCATCTGGGTG
TTGTCTATTAAGGAGGCAACCATGCCCCGGTCCGCTCGACTTATTTGTGAGGTGGGCCTTCGGTGCTTCCTGCATTGTTATGCAGTCTCCGGGAACTTGC
TCCACAATGTGATGGTTAGTCACGTAGCGATCTTGTGCAGTCGTACTAACGACCGAACCATACGTGAGGCCATTGCACTCACTCGTAGTACATCCACATG
GTGGTGGACGCTCCAAGACGTTCATCATATGGGCGTCTGGTGAACAAGCGGCGGGCATATCGACACTTCGTCGACGCCAGATGACTTGTGGCTCGTACCT
TCTGAGCCATGGTAAATCAAGGATAACATCAAATTTGTCATCCAAGTCGAATATGATGAAGTCATCATCGTATTGGACTTCTTTCAGTGTATAGGTAATC
GCCACTACACGTTTCATCACTGTTACGGATGCGCCTGTCGCGAGGCGTACCGTCATCCTCGTTGGAGGGATCTCTCGCTCGATGTATTTGAGCTTGCTAT
TGCCTAGCGATTGGCGTTGTGCAAAGTTTTCTGACGCCCCACAATCGACTAGGGCTCTTAGTGACATGTCCACTTCGAGCTTCAAGGTAATGAGGGAAAC
CTCATTACCAGATGCAGTAACACAAAATGATTGCGTGTTGGGAGCAATTCTCGTGAAGAGGCCTTTAAATTCACTTGACGTTGCTGGATCAGTAGGGTGC
TCCGCACCTAATGACCCTGAACGTTTTTTGACTGTCCGTTACGGTGTTGAGTTTTCGCAACAGCGTCGGACCCACGCGTCGGACCCTTCTTGGTCGCTTG
ACGTTTACTGTTTCCTGCGGTACGTGGCACCGCGTTCGGGGCACTGTATTCGTATGCATAATGACCTGTCTATTGACATCTATTGCGTCTCTGCAATTTA
TTGAAATAGGTAACGCGAGAGCTTTCACTCTCAGTGTAGCATAGGTCTATTGGTTCTGAGCCTCCACTTTCTGTCGTCTCGGGGGGAGCGATATGAACTC
GAGTTCACATGAGATTGTTTTACGCTAAAGGCCGCCTGTTCCGCAACCCGAATCACCTCTCCAGTGTACCAGTTTCTAGTCGGAACAGGTAGGTTTTGAC
TGAACCGTCCGTGAGGCCTTAAATGAACAACGTTTGTTCATTCAGCGGCTTTGCTGTAATGCAACTCGTAAGGTGATGTATGTACTGAATGTGTGAGTGT
ACATCACGTTTGTCGTGTTTGATTTTCAGGAGTTCAGAGCGAACCCTGAACTCAGCTCGCGGTGGTTCAAAGGTTTGTCTGAGATGGGATTTGAAGGCTT
CTAATGATCTAAATATATATATATATATATGGGTTGTGAAGCTTGAGACCCAAGTCTTCGTACGTCCTGCCAAGTTCGATTAAGTAAATGTGACCAGCAT
TTACTCATCGACGATGTGACGAGCCTTTATGGCGTCATCTAGCTCAACAAACCATCTCAACAGAGAGTCATCTTCAGCTCCTTTGTATTTGGAGATGTCA
ATCTTCAGCGATTCGGGTCGACGCGTGTGTCGACCCAGTAGCAGCAGCCTGCTGCTGCCTCAACAGCTCGAATTGATAAGACCCTTGTTGGTTAAGCAAT
GTCCTTTTTTCCCGTTCAGCGTCAAGCTCATTCTGAATGAACTTGGCGATGGTGGCGTGTTGCCCGTCTGGATCCAGAGCGGACAGCATAGCGCCTACGG
TTTCTTGCCCTATCGTCGAACTCAAGCGTCCGACGGCATCCCATTCAATTTGACTCAAATGGGAGTAGCTCTAATGCGTGGGGTGGAAGTCTCCCCCTTC
ATCATCCAACATGTTCATGGTCGTTGGACGGACTACTAAGTGCTACCAGGTTTAACGGG