Description :
From Genome Similarity Track
Location :
Scaffold_2308:23- 3072
Sequence
3049 bases(100 bases per row)
GTCGCTTCAAAGCGACTCGGAGTCCCAGGGCCCCGGGCTCCTTCCCGACAAAGGCCAGTGGAAGAGTGCTATCACATCTTCGAATAGCGAGAACGGGTTT
TCCCCGATCAAGGCATCTTGTGTCCACCTGGAAACAGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACCGCCTGAGTCTTTCCTGGCCAA
CCTCAAGGCTGGAGAGATCGCTGAGATGGTACTCATAAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTTTGTCTTGGACGAGAACGTCCTGGAA
GACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGTGACGGAGTATGCGGACGTGGTGAA
TAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTC
CCGCGCGAACAGTGCGAGGTCATTGATGGCTTCTTCGCCGCGAAAGCAAAGGCAGGAATGGTGCGGGAATCGAAATCCCCGCACTCGACGCCGACTTTCT
GCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACGACGCAACGGTGCCGGCCCAAACACCGATCCGACGAAATGATGT
GTTGTTGAACAACATGGCTGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGATGGATACTACCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACC
GCGGTAAGCACTCCAAGCGGCATGCTTTGGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGCTCAATCGCCTGGTGACGCAATTG
TTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGAAGGTGCATCTAGGG
ACACCTTCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGC
TTCGTCAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGG
GCTGGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAACA
AGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGAT
GCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGACGACACGGCTGGACGGGAACGAGTCATCTCGTTCCAGTCCCGGCAGCTCAAAGCCGCCGAGC
GGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACAC
AGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAA
TACAAGCCGGGCAAGCTCAACGTGCTTGCGGATGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATC
GGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCATTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACA
GCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGAT
CTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGA
CCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTTAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCC
CGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGG
CTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCC
CAGAGACGATTGTCTCGGATCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAGCTCGTCTGCAGATGTCCACTGCGGA
CCATCCGCAGACCGACGGCCAAACAGAGCGCGTCAATCATGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAG
CTCCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTTCACGGGTTTCACGCCGTTCTTCTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCA
CTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAA
ACAGGTGGAATCCTTTATGGATACCAAGCTGAACATAGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAA
CAAGGAAGAGGAAACTTAAGTATATTTGAGGTTGGTGACTTAGTGTTGCTAGACACGAGGAACCTATCTCTAGACACTGTTAGCTCTGTCGGCAGCAACA
AACTGAAGCACCGCTTCATCGGGCCTTTTGCAGTCCTGGCCAGACATGG