Description :
From Genome Similarity Track
Location :
Scaffold_3645:23- 2472
Sequence
2449 bases(100 bases per row)
CGTAACGCGCCCCCTCAGTTCGGGTAATACTTTTTCGGACTGTATTAGGGCCTTTTTGCAAGGCAAAGATCATCAGCTTCTGGCCGTCACCCGTGGGCAC
CCCCAGTGTAATATTTAAAAAAGAGGAACGAGTGGGGATATTCGTTAAGTCCATTGATTCCCGGCTGGGTAAACGTTCCGACCTCGATGGTGCATCCCGA
GCCCCTTAATCAACGAGCTGTTGGGAAGATTTGCGATAAAAGTCCTCTGGTACTGTTCTCTAGACATGCCCAGTGGTTTTCGGGTGGTTACTATGACGGA
TCGAGCTCGCCCAATATCCGCATTCATCACACCGTTTGGCCTGTTCGAGTGGAACCGGATGCCGTTCGGATTGAAGAACGCACCCCCAGATCTACCAACG
CCTGATCGATAACGCCCTCTATGGATTCACCCGAATACCGGAGTCCGAAACAGGTGGGTATGGGGAAGGCCATACGGAAGTGGATCCATTCGAAGCGGGG
GAGCCAGGGGACCCTGGGACCCCATCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTGATCCCGGCGGAATCGTGGGATCAGTTGTGCGAGAGAG
TGACGTCCTTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATTAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGAGTACTTAGGCCATCGAGT
TTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGCCGATTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCTTTCTTGGGCAGT
TTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTACGAATTGAGAGAGGTAGATTTTGCCGCGATGACCACTCCAGCTG
TCCAGATGAAAATCCAACAAGCTCTGGCCCAGGAGATGCCGGATCCACGAAGGGATCCAAGTGGTATGACGTCAGAAGAGGACCTGAAACAGGAGCTGGA
TCCACTCCGGGACCAACAGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAACGTGGAACAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCA
TTCGTGGAACTGAGGAACAGAATCGCGACCACGCCTATCCTCCGTCACTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAG
TCTCAGCAGCTCTGGTTCAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAATTGAACTACGGAGCGGTGGA
GAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACTCTACGTTAGCCTGG
CTGTTCAAGTCAGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAGTGCTCGAAAGGGGAAGACG
AGATCCTGGGAGTCTTGGCCGCGAGCAACACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAGGATCGCCCCTAAGAAAGAGCCCAAACGCCGGATCCA
GATCCCGATCCCGACGGTACAGGTGGATGAGGATCTATATGTCCTGAGTTTCGATGGATCCGCTCGTGTACGACGCGGAGGGGGAGCATACAGTGCAATA
CTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAGGCGGAGTATAACGGACTCCTTCTGGGTT
TGGATTTACTAAAGGGACAAGATCCGAAAAGGTTGGTGATTTGTGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGCGAGCTTGACTGCAAGGCCCC
GGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGATGAATCACGATTTGGTGCATGTCAAGCGAGATTGGAATGACAGTGCAGAT
AGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGG
TGGTAGTGGGATCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTCGAGGAAACATTTGT
GAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGT
CGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCCTACGAAGAGAGTCAACGAG
GATCGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGG