Description :
From Genome Similarity Track
Location :
Scaffold_3865:23- 1909
Sequence
1886 bases(100 bases per row)
GTCGGAACCTTTTGGCGATACTTGCCGGATCCGACGCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCAGCACTTCCTCAAGTTCGTCTGCG
TCACGGAAGTCGTAGCAGGGTCAGACTGTCGGCCCAGATCCACGTCTCCCAACGTTTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCC
ATCCTTGATCTTAAACTTGGCCCGTAGATCGGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGT
CGTGCCACCGATACTCCCAATCCACAGTACTGGGTCTGGTAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTACCCAGCTGCCGATACCAAT
TCCTGACTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCATGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGT
TCTCGCTTGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGACCCACCTGCCCCG
GCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTTGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCT
CCACGTCTCGTGCCCCATGTTCGTGGAGCACTTGCGCTTGTGGCACGGGCGTTCTCATACCTTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTG
TCGCTGCAGGGTACCTGAGGAGGTGTCAGAAGAGCTTGTGGCCGGCTGGTCCACTGGTGAGACAGGATCCGTGAGGCGAATACCTTGCGTCTCAAATTTG
AGGGTAAAACCCACTGGCTTCTTGCCGGAATCTGGCTCGAATCCTGGCTGGAATGTTGTTCAGATCACGCGTTAGGGCGTAACTCGATTTCGAGCCCTTC
ACGTTCACAGGGACCTCCTGTCCTCGACTCCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCAGACGACGTGTCT
GACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGG
ACTTAACTTTGGCAAAGAGGTCCCGCGTCGCGGATACTATGCGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCCACGATGCCTGA
CTCCGTCAGCAAACGTAATAGATCTTTGACTGCTACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGA
TTCAGGATCTGCATGACAGGATCTTGATGCAGGAGGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTGGTCGGACCAGCTAGATCTGAATC
CAGCTTGGTCTTCGTCCGACGCTGGAGCTTGCCTTTTTATCCCGGGTATTCTTACTCGTTTTCGTCTTCTTGCTCGTTTCTTCGACTAGCGGGCTTGGGT
TTAGGTACGGTGTTGGCTTAACCGATGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATC
CGGAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTTTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAA
CCCCATCGATCCGCGGATTTTGTTTCATTCAGCAGCATCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTT