Description :
From Genome Similarity Track
Location :
scaffold_2177:23- 1452
Transcript NameFunction/comments
Pl_100104conserved hypothetical protein

Sequence
1429 bases(100 bases per row)
TAGACGAGTATAGAGATAAAACACCGGGACACCCAGTATCAAGACATACATGATAACTTTGTGATAGTAAGTATGGACAAGTGTTTTTAGTGCTAGTACT
AACGCGACCGATGTTGTTTGTTTAAGGTCGACGGTGAGATTGTGATTACCGGCTCGGCTTCGTCTAGACGAGCGCGTGCTCCGAGTCCTCGGTGATTGTG
TAAAGTTCCTCCAGGCACATCGTCGACGTCCTTGTCTGAATTGGCGACTCGTTCGAACCAGCGTTGTTAACTTCCTTACTGAGAGGCGATGGGTTTGACG
TTGTAGATGGAGGGGTGTCCAGAATCGGAACTTCGTCACCACTTGTAGTGCCGTTGCTGGTCGACTTCCAGTCCAGCAGCTCGTCTTCACCCAAATCCTT
GATATTCAAGAAGGACCTGACAGCTTCAAGCACTCTGCACTGCGAATTCACACAGCAACGAACTTGTCGCTTGGAAGCTGTGCGGTACACTGCAAGTATC
ATCTCGACGAAGTGTTGCAGTTGAGCTTGTCGTTCTCTAGCCGTCTTGATATCGTCATCTCGGTGCATTTTGAACCTCATTTTGCGTCGAGGGAATTTCA
GCGTTGCAAGTTGCTGCGAAAGCTGCATACACGCTCCATTTCGACAATCACCTTTGCGCTTCTCCCCTGCTGCAATTGCGACCTTGCGGTCCAGCAACAA
TTGCTGTCTCAGGTCGCGGAATTGCGAATAGCGCTTTTGCAACACGAACTGCTCTCTGCCCGTGTCCACATGCAGCTTGAATGCACAGTGGTTGTCCACG
CGAGTGACGCCTAAGAACCGGACGCTGGTTTCAATGACTTCGTGTCCGGGGATGAAGCCGAAGCTCGACAAACGCGAGGAACCGAGGTCCGACGACAGCC
TCAAGACTGCTGGCATGGAGTTGCGTCCGCGCATCTTGTGGCGTGAACGATTCAAAGTGTCGTCAAAGGACACGGAGCCGTGGTGCGCAAAGGATTCAGC
TACATGACGCTCCACGAGCTGACGGGGATCGAGAGCCAATTCGTTGATGGACAGCGCTGGCATGCCTGTGTCAATGGACAAATTGACAACTGGTGGGTCT
CTCGAATCTTGCAAATTGACGAGTGCTACGCTGACCGGAGCGACTAGGACGTGAGCGTTGGGCACAGCTTCGAAACCAGCGAGTCTGGACAGCAGTTAAG
TCGACAACCGGCTATGCACTCGTGTCTCGGTGACACCAGTTGCTGACAACTTGCACATTACACACAACCGCTTCAGAGAAACGACGTGGTCAAGTGGCAT
GAGTCGTGCATTATTGCGAGCTTCTGGCAACGCAACTCGGCTGTTTCACTGGTTGTCGAGCGACTGGATTCCGCCAGCCGTATATACATGGAACTACTGT
TAGGTGAATCTCCGACGTTCGGAGATTCT