Description :
From Genome Similarity Track
Location :
Scaffold_182:23- 1412
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_182-snap-gene-0.20Chromosome 05 contig 1, DNA sequence

Sequence
1389 bases(100 bases per row)
GACTTTGGTCACTGGTGAACGCCATGAAGGAAGACCCTGCCGTCGACTGTATTTAACGATGCAAGATGGATAGCTTTGTGAAGCAACGGTTGCCCGTCCT
CCTCCGTCTTTGGGTGCAGTTAGCTGGCCGCCTAAGCTCTGGTGGTTAGTGCAACACGAGCCTCAGGACTCGTTAACGAGGTTCCTACAACGATTTCACC
GATCAAAAGAAGTTACCGAGTAGAGATTGTAGCAAGGCGTATTGACTTATCAAAGCCTATGTTTTCGATAATTTACAGCGATTTACACAGAAATCGAGAT
ATACTACATGTGACATGCTAGTGTTTTGGCTTTGACTAATGAATGAATGGAGTGGACTAACTCTACTGAATGGCTCCGTATTGTAAACTGCCATGCTGGT
TTGACAACAATGTCGTGATGCGCTGCATAGAGAGAGAGCAGCACTTCAGAAGGCAGGCGGTGTCCCACATTGCTACTTGGCAGCCAATGGGCCCTGGCGA
TCAGCGTGATGCAGACAAAGAAAACAAGATCCAAAGTTTTAGATGTTCGTCTGTCCATGCGCACGAAGTCATGATGGAACGGTTGTACACTGGGGGAATG
GGCTTGCTGCTCGCTCATCATTGCAATTTGTCCAACACAATTAATTCTGCGTCGGAGGCGCGTTCAATTGAATCACAGGTTGTTCATCAAGAGGGGAGGG
GGGGTCTCCAGTAAGTGAATGCAGCCCTGAATTGTCTCAGTGTTTTGAAGTTGGCCCTCAATAGGCAAAGCCTTGACTGCAAACACAAATTGAATCGAAG
GAGATAGACAAAGAAAGAGAACGCATACAAAACAAATTTTTCTATACCTTGTTGTGCGCGTGTGCATGCAACTCCTTACGAGGGACAGGCTTCTTAACTG
GATAGGAGACGTCGTTTGTCCTGTGCGAGACGAGCAAGAGCCTGGGTGGCGTAGCCTTTCACGTTGTTCGTCGCTGTTGGTTTCGTTGGCCAAAAGCCGC
ACGTGACGCAGAAATCCTGGTCCTTGTGCGATAGCTTAAAAAAACACGCCGGACAGAACCCGTCCTCAATGGTTTCGTCTTCGTTCACTTGCGTCGCAAT
AGAGCGTGTGCGCTGCTTTGGCACGTTTGCAAGATCCTGGCCGAACGCCTCGAGAAACGCTTGGAAGAAAAACAAATGCTCGTTATCGCGAACAAACACG
CGGTGTTTTTGGAAAATCGCCTTTTGTTGTGCCTCAAACTCTGATTTCGCCCATCGCGTGTCGAAATAGCCCATCCGCAGAGCCGTCGTGCCTGATCCTT
CCTCGATCGGCTGCTTTGATCGCCATTGCGAAAAGCTCTCGGGAAACGCCTGACGGAGAATCAGTTTGCCGTAGAGCACGCTCGCGCCT