Description :
From Genome Similarity Track
Location :
Scaffold_1142:23- 1204
Sequence
1181 bases(100 bases per row)
CGAAGCGCCTGGAGAAACATATCCGGAGGTTCGTCACGAAACTCAGGGACACGCGCCTCAAGACGTCGCTGCAGGGCCAGAGATTCAGGAGTATCGCTGA
TCTAGAGTACGCTCTGGAACAGGACGAAGATGTCTGGAGCCGCAGCGACCATGATGCTCCGCCACCCAGAGTTCGTGACTTTCGTGCCGACAATATTCCT
CAGGGACGTTTCAAGCCGAAGCGACAAGGACGTGCGTATGTGACTAGGGGCGATGTCTCTGACTCTGAGCCAGACGAAGACCCTGAAATTCACGCGCGTT
TCCAGGAAATCACGGACGAACCCAGAGTTTCAGCCCGAAGTGCGAGCGCGAATTCAGGGTCAACTCGTGAGATCTCTGGAGAAGAAGCTTCTACGCCTAG
CGCTGGGAGTCTGGCGAGTATGAAGGGTGCCAAGTGGACTCAGACGCTGACGAACGAGGTCTATCGCGTGATGGATAACATGGGATGGCGTCCACCGAAC
GCCCAACCAGGACCGAACGCGAACTCTGGATTCCGTTCCCCTCGCCGCGAAAACCCGAATTGGGACAAGTTCTGCGAGAAGTGCGGCAAGTGGGGGCACC
CAGAGGAAAACTGCTGGAAAGACGTGAAGTGTGATCGCTCCCTGGAAGTGGGTCATCCGACTCACTTGTGTCGCGCGCAACCGTGCGAGAACTGTGGCAA
ACTGCATCTCGGGAAACCGTGTGAAGACTGGAAGACACTGGAAGCTGTGAAAAAACTCGCCCGCCAAGGTGCACTGAAGGACATGCCGAGCCAAATCCTG
GATAAACTCCTGGATGGCGAAGCAAACTCTGGGAGGCCGTCAAACCAATAAGCCCGCTGGGTGGGGACCCAGTACGCGCCGGGCTGAAGAAGGCCCCAGA
GTTATGTGTTCTAGTGTATGTAGGCCCGGAGCTGAGAACAAGAACCCAAGATAACCAACAATGCATGACTACTTTGACTCAGGATTTCATGACTTCCCCT
GAAAACCAGCATCCTGAACAAGCGAACTCTGGGTCGGTGAACTCTGAAGAAATTGTGGAGTACAAGCTGAACCCTGGAGAGCGCTACGGATGGTGGGAAA
ACAATGATCCTGACCCAAAGAAACGTGATGTGGCGATGGTGCATGGTGCTGTGAACGACTGCCGGACGAGAGTTCTCCTGG