Description :
From Genome Similarity Track
Location :
Scaffold_3552:23- 1126
Sequence
1103 bases(100 bases per row)
TTTTGAGGCTAGATAAGCATGATTTAGACCATGATTCGGGAGCAGGGCTTATATGTTCTGATTTCTCTCGAGCTTCCAACCGGATTCCTGGGCGAGAGGG
CAGCGGGCGATCCTGGGCATATCGTCCCTAAGTTAAGGGATTCGGCCGAGCGCATGGTGCAGACGATCACGAGAGTACTCAAGATGTATGTCCAGGATTT
GGATCAGAGAGATTAAGATGAGTACACAGAACGACTCCCCTTCGCGATGAACCCCGCCCAAGACAGGATCCGGGGTGATACCCCATTTTACTTGGTACAT
GGGTTGGATCCCAAATCCACATTAGAAGCGGCCATTCCAGTATGTAGCACCAAGAAGAGAAACCGAGATCCAAGGAGATGACGATACCAAGTCCAGAAAT
GCTACCGGCAAGCCAGATCCCAAGTGAACGAACGGCTGCGGAGCGCGATACAGGATCGAGCGGATCGACACAACGAAGACGCCCGTCCGCATCAAATCCA
AGTGGGATCGCAGGTGGGGCTTTATTTGGATCGAGTAAAAGAAGAGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAAAAG
ATAGGAGAACATGCGGTAAAGCTGGAAACGGCAGGTACCGAATATCGCTTGTTCCCTGTTGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCAG
ATCGACCGGAAACCCGTCTTTCGGTGGATGGATCCGACCGGGTAGACTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGACCTTGAGGCCGA
CGAGTTCGAGGTCGAGAAGATCACCGACATGAGGTCAGGGAAGCGAACTAGATACGGACGGATCTACCGTGACTTTCTGGTGTACTGGCGTGGACATGAC
GAGCCCAGTTGGGCAGACGAGGCAGATCTGAACTGTGGAGCATTGCTCCATGATTTCTTGCGGGGTCGTACGAATCGGAACAGATTCGGCGTGATGCAGT
CTCATGAAGAAGAGTAGAGAGGGGATCCATGGATGTGAGTCGGTCATGTCGATGGAAGGATGAAGAAGGACCCACAGGAAGGGTGTGGGCCAGGAGGAGG
AGG