Description :
From Genome Similarity Track
Location :
Scaffold_2585:23- 1125
Sequence
1102 bases(100 bases per row)
ACGTCACTCTTTTTGCATAAACATTCACTCCTTCCTCCTAATCCACCCCTCTCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCATATCA
GCGATCCTCTTTCTCCCGGCCCACACCCCTCCTGTGGGTCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGAATCCCCTTCCGACTCTTC
TTCATGAGACTGCATCACGCCGAATCTGTTCCGATTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAA
CTGGGTTCGTCATATCCACGCCAATACACCAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATATCGGTGATCTTCTCGACTT
CGAACTCGTCGTCTTCGAGATCCACATTCCAACTATCTTCCGACTTCGTCGAAATCCACCCGGTCCGATTCATCCACCGAAAGACGGATCTGCGGCCGAT
CCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCTAGCCTTACCGCGTGTTCTCCAAT
CTTCTCGCTCACCCGGAACGGTCCGTGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCCTTCACCCGATCTAAATAAAGCCACACCTGCGATCCCACT
TGGATTTGATGCGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTTCGCAGCCGTTCGTTCACCTGGGATCTAACTTGCCGGTACT
ATTTCTGGACTTGGTATCACCATCGTCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCCAGGGTGGATTTGGGATCCCACCC
ATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTGTTTATCGCGAAGGGGAGTCGTTCTGCGTACTCATCCCAATCCCTCTGATCC
AAATCCTGGACGTACATCTTGAGTGCCCTCGTGATCGTCTGTACCATGCGCTCGGCCGATCCATTGGCTTGGGGACGATATGCCATGGTTGCCCGTGTTG
TC