Description :
From Genome Similarity Track
Location :
Scaffold_6065:23- 1087
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_6065-fgenesh-gene-0.0GPI ethanolamine phosphate transferase

Sequence
1064 bases(100 bases per row)
TGGGCCGAGGCCGCATTCGTGGTACTCTGCCTGGAGCTCGTGGTGCTGGGCTTCGAGCGGCGCTTTATCTTTGGCGTGGTCTTCTCGCTGCTGAGCGTCT
GGCCTTGGCTCGACGGCTCATTCACTTCTGCTGCTGACGAGACCTCGAGCAAGAGAGCGACGCTTCAGACCTGGACGGCCAGCTGCCTCTTCATCTCCGT
CTTTCCGTACTTGTCGACCGAGTACGGTGAGCACACTCTTCTCGTGGTGGTTGGTGGCCTTGCGTTGCTGGCGTCCGCCCTTGCGGCAGTCGTCTCGCAG
TCGTCATCATCTTCAAGAGCCAATGGCAACAGCAGCAAACTGTCTTGGGCGCTGGCGTTCGCAGTCGTGGGCGCTTCGTTGGTCACTGTGCAGTGGACCA
TGAGCTACCTGGAGACCAAGCACAAGCCGCCGGTGCTGCTCACGCTGGTCAACTGGGTGCTGTCGATCGCTCCGATCGTGGTGCTGCTGGTGCGATTGGC
GTTCAAGACCGCTGAGCTGAGAACTGGATCCAGTGAACAAGAAGAGCTGGAGGGTAGCGACGTAGTCAACCTGAAGCTGCAGACCAAGATGCTGCGGCGC
ATGGTGGAGATCGTGCTGGCTGTGAGCCCCGCGTACATCCTGCTGAGCATCTCGTACGAAGTGTTCTTCTTCCTCGCGCTCTGCTGCGTGCTGGGCAGCT
GGATCGTGCTCGAGGCGCAGCTGGCGACGGCAGCCAGTCACTCATCATCACCTCCAGCTTCGTCGACGCTACGCCACGAGGCGCGACGCGCGTTCTTCTT
CCTGCTGCTCGTCAAGATCGCGTTCTTCGGCACGGGCAACGTCGCGAGCATGAGCAGCTTCGAGCTCTCGTCCACGTATCGCTTTGTGACCGTCTTCGCG
CCCTTCCTCATGGGCGCGCTGCTCGTGATCAAGCTGCTCATCCCGTTCCTCGTCGTCGCCTGCGCCTTCCATGTCGTGCTGGAGCTCGTCCACGTCAACA
GCTCATCTTCAGCAGTGCGCCACCCGCCGTCGCGCTACTTTCTGCTCGTGGTGGCCATGGCGGA