Description :
From Genome Similarity Track
Location :
Scaffold_71:23- 1025
Transcript NameFunction/comments
g5361.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
TACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGTAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGAGAATG
GCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACAATTTTAAAT
TCATTTGTGTTTCCTCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGAC
GCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTAAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGTTGTTCGTTGTCGTTTGA
AGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGC
TTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCAC
GTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAA
CTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGACCGACATGGACAACTGCGTCCCAAGAAGT
GTAAACACTTCTTGCCAGAATCGCGCTGTGAAGCGCGGATCCCGATCCGACACAATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACA
GACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGTTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTT
GT