Description :
From Genome Similarity Track
Location :
Scaffold_6:22994- 25287
Transcript NameFunction/comments
Hyaar_Emoy2801215hypothetical protein

Sequence
2293 bases(100 bases per row)
GCACGGGACCGTAGGCTACCGTCTTCTGCAAGAGCCGAGCGACATGTTGTCGAATGAAACTCAGCACGTCACACGGGGATGGATTCACAGAGATCTGATG
GCCGAGGGATGGTTGTAAGAGGAAGATGAGTATTCGTATGTACCTGCTGAAGGCAAAAAAGTGCTCGTTTCCATTCCTTGTCTGACCAATCAGGGACTAA
AATGTTCGTTTCATTTCTTTGTATTGACCTATCAGGGCATCGTAAGTGTGAAGGGAGGATAGTTATGGCGAGGGGGTGGATGCTTAACGCCTCCCAATGG
GAATTCTTATTTTCACTTCCTGAAGGTACAATTGGGGAGCAAGTTCTGGAGCTCACTCTTTGATATTATTAATTCAGTCCATAGAACTGAATCATGCTCT
GTATATTCACGTACCTTGCGCTAAGTCATTATATCGGCACCCTTCGGGCTCGCAATAATGCCTATTAACAATGAAGAGGGAATAATCGCTACACACTTAG
TACGACGCGAAGGGTACAGCTAAGGTATTAGGCCAGATTATGGCCGATAATTGGTAGGAGCCGATCATATACTAAAGCCATTTAACCTGAGCAATTTGGT
TGACTTGATTAACGAATGAGTCAGTATATGGCCACCCCCACGCATCAAACTTAGGTTGATCACATACTGCAACAACGCACGATGAAGAAAAGAAAGGTGC
ACAGCCAAGACGATCTCGTGAAGGCTTTCAGTGCTCGTGAACAAAATTGTCGTTAGACACAATTCGTAAGTTGTTTCCCACCGTTCCAGAAAGAACGATC
CGCCGCCGCGCTACGCAACATCGCTCTATTGTGGCAATCAAAAGGACCGGACCACCGCCCTCCTTTTCCAAGAAATTGAAGACGACATCCAGACGTGGAT
CGTAGGGATGCAGCGAGAGGATATCCCTTCTACGCGTGGGATGGTACTCAGCAAAGCAAACGAGGCGTACGTGCTTTACGGTCCCGCACGACCGGATAGG
CTCCTGGGCAACGGATTTGTCAAGCGATTATTTTCCCTTCACCCCAAGCTTTCACTCAGGGTCCTTTAAGCGATTTCTCGCGCGCGAAACCAAGTCCGGA
AATAGAACCTCGATCAACTTTTAAATCAGCTGATTAAGCACGCGATTGAGCGCAAACTAACCAGTGACAGCATGTTCAATATGGATGAGACGAGATTTGG
TCAGAAAACAAATTCAAGGAAAGTCATCGCTGTGCGTGGGTCAAAGAACGTTTGGACACATTACATCGACATTAGCTTTCATCTGACGCTAGTCGCCTGT
GTCAGTGCCTCCGGAAAGTGTCTGCCGCCGCGCTTCCTGCCTCTCTACAACAATATTTGAACCGTGACATCTTGAGTGAGTGCATCATCCCTTCTGCCAC
AATCACTGTCGCTTCGAAGGCGTTCAGGAACCAAGCGATCGTCGTCAAGTCTTTGGAACACTGTTCGCAAAGCTTTACCCAGCAGCGTCACTAGGCCACT
ACTGCTCATCTACGATGGCTGTGCGAGACATTACAGCAAGATATTTGTCGGGAAGGCGATCGAGACGAAGATTTTTCTATTTTCTTCCTCCAAAGTCCAC
ACACTCCTTGCAGCCCTTTAATGTCTCCGTGTTAAAGCCCTTCGAGACCAGCATTCGTCGCTCCATGGACTGCTTAATGATCAATAATGATGTGTCGAGC
TTGACGAAGAAACAGGAAATCTCACTAGCATCGAGCGCGTGGCAAAATATTGTGCTTGTCAAGCCAGACAATGTTATTTCTGTCTTTGCAAAGAATGACC
TTGTCCAATCTCAGCACCCAAGATGCGTGCTCGGAGAGAATCATACGCCGGTGGAGGTGTTAAGAATGGAAGCTTACCAAGCAAATCGGTGCGAGTCACA
GTGCGACCAAAGCTCCGTACGGAGGTACTATTCCTGCCGAAGTCAACAGCTAAATGCAAAGGAAAGCGCAAGACTGTTGACATTCTTGATCTTTTCATGA
CTCAAGAACAGTTGAAACAGATCAAGTGATTTAATTAAGTTTGTATTAGATTTGATATCGGCCATATTCTGAGCCATTAGCAAAACTTCCAGAATTTTTG
CCTCTTTGGTCTGTTTCATAACTTTCTTTCATTATGATTCTAAGCATGAAGGTTTGCTGCAACGGCTAAGCTACGGTCTTCCAATTACTTTGAGCTATTT
CGGAGCAAAAAACGAAAATTGAGTCAACAATGGGTTTTAGCTAAGATATACGTATATCGGCCATAAACCAGTATCATACTTTAGTGTTTTTTT