Description :
From Genome Similarity Track
Location :
Scaffold_73:229929- 235903
Sequence
5974 bases(100 bases per row)
GGTCATGTGGTGGATTCTCCGGCTGACAAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGCACCAGAGCTGCTGAGACTGCCCAGTCACTGGCATAA
ACTATTACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCC
ACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCTGTTGGTCTCGGGGTGGATCCAGCTCCTGTGTTAGGTC
CTCTTCTGACGTCATACCACTTGGATCCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTCATCCGGACAGCTGGAGCGGTCATCGCA
GCAAAATCTACCTCTCTTAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCA
TCGCTCGTAACGACTGTGGGAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAGGTAATC
CACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTCTCGCACAACTGATCC
CACGATTCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCA
CTTCTGCGTCACCTTCCCCGGATCCACCCGTTTCGGGCTCCGGTATTCGGGTGAACCCATAGAGGGCGTTATCGATGAGGCGTTGGTCGATCTGGGGTGC
GTTCTTCAATCCAAACGGCATCCGGGTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAG
AAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATCAGAGGCATCGGATACACCACCAATCGAGTCA
GGCTGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACCGGCGACGCCCACGGGGACGTTGAGAAGCT
GATGATCCTGGCTTGCAGCAGGCCCTTAATCAGATCCGACAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCG
CCGACATCGATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAACGCATTACCCTTACCGATCAGCAGATGTCGGCTTTCCCAGATCTTCTGACGCAGAC
GATCCACTTCAGTGGGTTCGTTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATTACCGCCATACC
TTCTCCAAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCTTCGGTCTTTGTCTGATCCACCCTTGGATCCAGGCACCGCGAC
TCTCCTTCGACCGTCATCCCTTCTGTCTTCGTGGGGTCGGGTATCCTGGTACTGGGGAAGTCACCGGTCGGATCCAGCCGGTCCTCTAACGAGTCTAAAC
CCGACAGTTCGGGTTTGACTAGCGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAGTGGAAAGCTTGGATCCACTTGTGGATCGGCGGTATCCGG
CTGTTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCATGGATCCAACCTCCATT
GCTTGGATCTCAACCCGTCGATCTCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCA
CCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGG
GATACCGTCCTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCT
GGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGGTCTGACAGCTCCCAAGTTTCCC
CGGGCTCGATCCAGGTGGTCTTATCCGCTCTTATGATCCTCATCTTCGCTCCATACAAAGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAA
ACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCTGGTACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATG
TCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATTCGCGTTCTTCCGTTTGTACGGTATACGCCTTCACCAATTCCAACACAATCTTGGATCC
GACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTT
GATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACA
TCCTCAGATCCACAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCT
CCCAGTAACCACGTGTCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTTGGATCTGGAAAACTCGTCCACTTGGCGCAAACTAGAGACCCTGGCAAC
TGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCCTGTTCACAAATGCATAAATGCAGTACCTA
GAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACTTCCGGCAACATCCCTCGGTGCTTGGCTGGATCAAA
CCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGA
TGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGCCC
CGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGC
ATTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAGCCGTCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGA
GCTGGGGCCGTGGGCGTCGGGGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTT
CCTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAATGTCTCGATGAAATGATCCACGTGTTCCCGCAG
TACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTCAGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATCTGCGGCGA
GCATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCA
GCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCTGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTAAC
TTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACTCTCTGGATCATGGAC
GATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCCTCCAGATCGTCTGGGTCGAATTCATCATGGGAGTTGTCTCCCT
CCACTGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGAAGCATTTGCACTTGGGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCAT
CGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGTTCCACTGGCGAGACCGGATCCGTGAGGCGGTTACCT
TGAGCCCGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCGTACTGGGTCCCGAG
CCTTCGCGTTCACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGA
CGTATCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGTGACGACACTGGATCCATAGTACGCGACCTTTCTCCG
GTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGA
TGCCTGACTCCGTAAGCAGACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCCCACCGGTTCCCTTGGATCTTCGATCTG
TCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCCTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGAC
CTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGC
TTGGGTTTAGGTACGGTGTTGGCTTAATCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTACGTC
AAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAAATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTC
CCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCATGCTCAATCTTCACTTGAG
CATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCA
GATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTA
GGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAAT
CTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTAGCCGTAGGGTTGCCTTGCG
GGTGTGTTCCCTTGCCTTTGCGTTCCTTTGCGTTGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGA