Description :
From Genome Similarity Track
Location :
Scaffold_1281:2298- 6256
Transcript NameFunction/comments
Phypl_g12989hypothetical protein PHYSODRAFT_518156
Phypl_g12990Amino Acid/Auxin Permease (AAAP) Family

Sequence
3958 bases(100 bases per row)
TATGGTAGTCTTGTGGCAGTCATGGGGTCGTAAATCCGTGTACATTCATGCGTAAGTGTAATTGTAAACCTTTTGGACTAGAGCTACTACACGTTAGCGA
AATTATTATCAAATGCAGGCGCAGGTGTAGGAGCTAGATCTTGTGCGATTTCCAGGTAGAATATGTCGGAAAGAGTCCGAGAGCTCACTCCTTGAAACTT
GCTGTCGTTCCGCTTCAACTGAGGTCGCGTGGGTAGGAATGACACGTCGGTGGTTGTGCGAGCAGTTGTTCTCTCATCCACACAGTCTGGGACTGCAGGC
gtaagtacatgtagcgttGGGGTCGCTAGCAGAGGGCGTGGGGGCAAATAGGAGTTCTCGTACGTTATCACCAaaccttcctcctcctcctcactcAACA
CGCTCTGCAGAAGTAGCGGGTGATGATGGGTCAACATCGACTGTTCGATGCCTACGCTGTTGCATAGCTCCTCGCTCTGGGCTATAGCGACCAGTTTGAG
CAACTGGGAGTATTCGATTTGCATTTCCTTGAGCTCGAATAAGAGCCTGGCAACGCTGTTGAATCTGAAGCTTGACAGATGCAACCCACAGACTCGCAGC
ACCATTCGCACCTTCGCGACGTCGATGGCACCAGAACGATCTAGGTCACAAGCCGCTAGTTCTGCCTGCAGATCACCAATCGATAGCTTCTTCGTTTGCA
TATTCTCCCATAACAACGTTGCGAATTCGGAGCGCAGCTCAATGATTTCACGGAAGTGATCCACCACTTCGCTTAGCGTGCTGCCATCCACACGAAAAAT
GCTGCTAACCAGGACCAAACTCCGAAATATCGGCGGCTGCAATAGAAAAGTGTTCAGAGCTAGAGGAAGTGGAATAGCTAGCACCTCCAGAAGCCCCAAG
TCTGCGTAAACGATCCCGAGCTGGTAGGCCACACACTGCACTACTAACGCGAGGTAGAACCCGTTGAGCATCAAAAGCATCATCACTGTGGAGTGCCATG
ATTTCCGTGAAAACCACCGAATTTCGATCGCTGGAGTCGTGCCGGACTTCACGCTGTGTTTGTTTTCGTTGGGGCCGCAGCGTTTTCGATGTCTAGGtgg
ctcctgctgctcttgcacCTTTTGCATGACCAATAGTGCTCTGCCTGCGTCCTCTTGCGTCCacgctcgagcttcttcgcgcgcGATAGACCTGAGATGG
CTCTCCAAAACGGATTGATTTGCAGCCATTCCAGCAGCCTTCAGTAATTGATGAACGCACGAGCGGAAGTAAACAAAAACGACGgcatgcagcgccagca
gtgCCCAGGAAAATCCTATCATCACAATCACAAGACCACGACGCCTTGTCagtgctggtccagcataATTTAGAGCTGTTGTGATCCCTTCCAGCACCCA
AGCCACGACAAGTAACAACGCCCACATCGGTGCGCCCACATCGGTCATGTGTGTGATCTGGTTATTTTGCGCTTGCCGAAGGTACTTGGCAAATGGAAAG
AGCTGAGGTAGTTCGAACCGACTGAGGAACAAATGACGTAGCAAGCGCAAACGAATCAGCTCCTGTGTGTCTCGCTCCCTGTTAAATGCTGGCGAGGCCA
CAGCATCAGCCAAATCGTCTGCCGAAAGCAGCTCAGCTCGGTCTGCTTGGACGTTGTGCTTCCGCAGTACGAGGAAAATGCAGACAGCCTGCAGGATGAG
CGCCAACGCCAGGATGAAGATGGTCAGGTCTGCAATCTGAAAGGCGGTcatggcagcagcgtcaacgcTAGATACTTCCTTGACCACTTTgagtccgagt
ccgacgagTCCAAGGATCATGAGCTCGCGGTACGCCTTGCTaagcagctgctggtactTGGCCGAGTCGGCGGCACGGCGTTCCACATGGTGCAGCACAC
GTTCGAATATTAACAGAaacaccaccagcacgctcagatgcagcagcacgcgccacAACTCCACGTCGTCCCCCACGCGAAAGAGCGACGTCCCTCCCAT
GGTAGTGCTATTATACCTTTAGCAGCGAGAACAGTGCGGTGAAAATAGCAGCAATCATTAAAACATTAAAATAGGACGAGAGCCTCAACCGAAGCGATCA
GTAAGACAGATATTCTGCATTCAGAGATGCAATGTCGTGCAAGAAGTTGGTTCAAGGCAGTTGTGCAATCACAAAACGCTACATTCTGATCCGATTTATC
CTCGCTTGGGCAAATATACACGAATAACATGATCTCTGAGAGCCTTGGAGAATCTCTCAGATATCTAGGACTCATGCTCGGCCGTGTAGTTGTAGTAAAT
TTGGTTCTCGTACTCCGAATCGCAGTAGGGGAACTCTGTGTCGTCATCCGTCGGGGTGAACAGACTCTTGCCGGTCGTGTACGTGACGTAGCAACCAAGA
ATGAAGCACACTGCAGTCACAAtcagagcagcagcctttTCGTACATGGGGATGGTCCTCCATGCCTTCATGAGATAAAAGGCAATCGGCAGCAGAATGC
AGTTCACCGTGATGCACGAGGCACCCACGAAATCGGAGAAATCCGAAAAGTGGTCTTGGAAAATGATAGAAAGCACAACCAGGATGAcaacgatgacgac
gcgcagcacgatGTACATGATGGCGTTCTTCCCACCACGGTACTCAGCCGCttcggcctcggcgtcgtccttaAATTCGCGCTCGCTATCAGCCACGGAC
ACGTAGGACatcttggagctgcggcgaGACTCGGCCTGGACAATTGCAGGCGTCGCGGACTCGGTGTAACTGAGACCGGCCTCCATGTCCGGGGTTACCT
TCTTGTGCATACCCAAAGCCAAACGCTCGGCGATGTAGAAGGCCGGGTTGATCAGCACAGAGAACGCGATCGTGATGTGTAGCTGCATGAACAGGTaggc
cagcaccacggctCCCCAGCTCGGCTTAAATCCCAACGTTGTCATTCCGGTGTCTGCGTCCGGGTAGATCGTGAAGAGCAGGTTCCCCGAGATCTGGCAG
CCCACAGCTGAGTACGCCGTGCTGGCAAGAATCACGAACAGGCATGAGATGAAGCTTACGGTAACCAGAACAATGCGAGGCATGCGCGTGGGGTCGCtgt
gctgacgctgcaggtccGGAATGACGATACCAGCTCCGTAGGCCAGCGCCAGATTGCCGAAGCAACCCAGAACCTGCGAGATCTTGCGGTCGGGCGACGG
CACACTCGGGTGGCCGCGCATGCCGTACATGACGACAGCTACGCCGATCACGTCAGCGAGAATCGTGCCCAGGCATccagcgaaggcggcgccagctcct
tccttGAGCGTAGGGATGAGGCACACAGGCAGCACCATGAGAGCCATGAGGATGATCCACACGGTGGCACTGAAGGCGTCCGGGAAGAGGCCGTCAAGCA
GCGAGCCACCgagcaccaagaagacgcacgGGATAAGCAGACATGATCCCATCTGCGAGATGACGCAAAGCCAGCGACCAGTTTGCCCCATGCTCCACTC
GCCCAAGTCTCCGAATGTCTTAACGGACTTGGGGGCGAGCAGGATGACCTTGGACATCTTGACGGACGCGTAGATGTTGGCGAAGGCCATGAAGGCCATA
GCAATGACGGCGATGACGGGGCCCGCACGCGAGAAGTTGCCAGGCATACCGAGGGTGCCGATGCCGtacatgcagcagaagaggtTGAAGGAtgtcttgg
cgtcctcgacggTGAAGAACGGCATCTTGGACGGCGTGCAGGCGACTTGAGCCGGACGAGGCCAAACGCGAAATGGCGGATGCGGAGCGAGGGCACGTCG
CTAGCGGCTTGGAGTCCTTGCTCATGGGTCATGCCGGCGCCTGGGAGCGGCCCGGTCTCAGCATGCTGTGTTGCATCATCTGAAGGGGATGCACACAGGA
TGATGGACGCGTCGTCCAACTAGCAAAAACATGTGTGCATAGATGCTAATGTACATTT