Description :
From Genome Similarity Track
Location :
Scaffold_19:229740- 231426
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10238drug/Metabolite transporter (DMT) superfamily
Phypa_INRA-310PPTG_10239hypothetical protein

Sequence
1686 bases(100 bases per row)
GATGAAAAGTAGCCCCAGCACCGCGTTAAATGCGTTGGCATCGGATGTAGCCGTGTCATTTGAGTTGTTTCCCACACCAGCATATCCAACGAGTACAACG
GCGAGCATGACGATCCAGATACTTGCGTAGTGATATCCGTGTAGCTTCTTGCCCATGAGTCTCACCGAGAAGAAGGCACTGAAGATGATGATCGAGCCCC
TGGCCATCTGAAACACTGACGATGAGATCCACAACAAACCGACATTGCACAGAACAGTCTGCAGCAGATCTAGCAGTGCTGGCAGTGCAATCGCCGCCAT
CGTACGTAGAGATACTCGTCCCTGCTGGTCTTCCTTTCCTCCCAGCAGCCTCGGAGCCAGAAGCGGCGACTGCTCATTGGCGTCTTCGTTGTGGTGTGAC
CGGTACTTGCGCTTAAGAGCCTCCACCTTGTCCTCAGCCTCAGCGTGACCTGCGTACTTGCGTTTAATAGCCGACAATTCCTCCTTGGACGGCGCAGTGG
CCACATACCGTCGTCCTCCCTTATACATCCGCAACACCGGCGTCTCCAGATACTCGCGATGTTGCGAGCACTTGCGCATGTACAGGAAGGCCAGACATAG
TGTCATGGCCAACTTCATCTGCAGCACGCCGAACCATGGCTTGGCGAAGGGACACAACGTCGTCCCCTCACCTGTCTGTGGGTCCACACACGTGGCCGTG
CCGTGCGAACGCACCGCATACTCGGTCTTCATGATCACGGTGCTGAAGGTTCCGGAAACCAGCATGGCGATGGCCGACAACGCGCCCTCGCCCTGGAGAT
GCTCGCGCATCTTGAGCGGGGCAAGGTGGCAGATACAACAATGATACGAGGAGCTTGGCAATCAATTGGGCGGAGAAGGGGCACCAGCGAGCACTTCTAT
TGGTGGTAAATCGACCAATGAGAATACCTCCAACTTCGGTGCGAAATTCGTACTGCGAACGTGCTCAGCAAAATCTGCACGGAAGGAATCGCTGTTGCTA
TCTTGGCAGCAATGACACTTTCGGTCAAGCATCGATAGCAACAGATATTGTGTGGCTCATCTCTCATGATAATGGCCGATGGTACGTCAGATGGTGGCTG
CAAGTTACTTCGCCAAGCCTTATCCATGCAGCCACTTTCTTATTTACTGCGTTCCCAGTAAATCTCCTGAGCCGTCCTTTCATCAAGAGCTAAATACACC
AGTTATGGGCAATTGTCTCGGAAAGACTACCTCTGCCATCGCTACCACTGACTCGTTCGTGGACGTGCTGTTCTTCCCGGATCCCGCGATGCCCTGCAAA
AACTTCCACTCGGGCGAAGGCTGCACACGTAAAAATTGCAAGAAGATCCACGACCAGGGCAGCTCGCTCTTGACGATGCTAGGATACCTCAAAGGTGCCA
AGAAAACCATGGACATTTGCGTCTTCACGATTACCTGTGACGAAGTACGGACTGCTTGTTCGAGTTGATGGAGACAGACTCTGACAACTGTTTTGCAGAT
TGCAGACGCCGTGCTGGAAGCCTTCAACCGTGGCGTCAAAATCCGCATCATCACGGACGACGGCCAGGCAAAGGGCCAAGGCTCCGACATTCAGAAGTTC
ATCGATGCGGTACGACAGGAAGTTGGCTTCATAATTCCATAGCTGCAAATTTTAACTCGTACAAATGGCGTGTGTTGGTAACTAGG