Description :
From Genome Similarity Track
Location :
contig_10:229715- 231449
Transcript NameFunction/comments
g3298.t1ETM41731.1 hypothetical protein L914_12519 [Phytophthora parasitica

Sequence
1734 bases(100 bases per row)
GGCTTGAAGGTGTCGCCGGGCCACGTCGCGAACTCGCTGGCCTGCAGCCACCAAGCCGGGTATCCGATCGAGGCCATCTGGTCGGGAGCTTCGCCCGTCG
TCTTGTAGCCGTCGCTGTACTTGGCCACCACGTCCATGCGAGTTCCCACCACTGCGCCACGACCTGCTCCGCGAACTCGTTGCTCTGCGCTTGCAGGCGG
GTAACCAGCTCGGTGTCACTCACGCTACCAGAGTGACGCTTTTCGTGCGCCTCCTTCTCCATCTTGCGTCGTCGGGCAAAGGCCTCCTTCTGCAAACTGT
CGATCTTGCCTCGAATGTCGATGCTCATCGAGTTGTAGCGAGCAGACTCCAGTTGTTCACGAAGTTGAAGGCCCACCAGGCAGACTGCGGGTTGAACTTG
CTTTGTTGGCCCAGCAAATACGACTTGGGCACATCGTGCTGCGCGCAGAGAACGGAACGAAGACCGAGCCGTGCGGGGCATCCTGAGCATACCATGCAAC
GCCACCAACAGCATCCGGCCCCTTGTTACTACGACTCTGCAGAACGAAGGCAAACAGCGTGCGGTACATCGAGATCGGTCGTTCCCAGCCGCCAATGACG
CCACCGGGGCTACCCGACCATCGCACAGGGGCTCCGGGGCCAGCAGCCAAGCCCTTAGTCATGTCGTAGCGCGTGTTTTCGTAGTGGTCGCGGAGTAGAT
CCATGATCTGGAACATCTCCACATTACGGTCGGGCTTCACGGAGAACGGGTAGGTGGCGTACTGCGAGAAGCTGCCGAGACGGGCGTCGAGCTGCAGCGA
CGGAGCCAGCACGTCGAAAACGCGCCACACGCGGCGTCCAGTGTAAAGCGGGCCGATGGCATCCTTGTCCGCAAAGCCGTAGGCGGCAGTGAAGTCGAAG
GGCTTGTCCCCCTTCGGGTCCCACCAGTTCATTTCTTCAGCAAGCGAGCGCACATTACTCGAGGCCATGAACCAGTCGGGCTGGCTCAGGTCGATTTCAC
GGATCGTGAAGCCGTTCGCAATCACCGTCACATGACCGTCAGGCACGCGCTGCGCTGCCCACACAGCCCAGCTTCGTCCTTGCCGGTCATGACGTGGAAG
ACCCAGACCTCACCCAGCTTATCTCCAACGACAAGCGCTTCAGCCGAGTCGCCGAAGTCTGGTTTCGCCATATCTCCGCTGTCTTCGCTGTAGAAGCCGT
ACTTCTCGGCCAGCGTCCCATGGTGCCCACAGCGCACGCGCAGTCGCACAGCGTTCAAGTGCGATCTTGGTGAGCTCTGCGATGCCGAACATGTTCTTGC
CTCCAGGCACATTCAGCGGCCACCCGGCGGTCTTGGCCCCGCATGTACTTTCGCCAATGCTGAGCTGCACCTCGTTCATCATGCCATAGTCCTGGTCGAA
GTACCCATACGTGTGCTCCACCTGCGGGACGTACCCAAGCGGCATCATGTACTCCTGCTCCACCTCTGCTAGTGGGTCGTGCACAGGCTGGTAGTGGGGG
CCACGGTCCGGCGCCACTACTCTCGGGTATCCGCCGTTGAAGTTGTAGACGGCACGCTTGCTGCCCGGCTCATGATCTTGCGCCGGAACGCGAACAAGGC
GCAGATCAGAGGCTGCATCACCGGCATCGTCCGTGTGCGCGATCAGCGTCGAGTTGTCTGCGCTTGCTCCTTGAGTCACAGCAATTGCTGTACAGGCATC
GACTTGAACCTGTTGCAGCGAAGCCACCGCGAGC