Description :
From Genome Similarity Track
Location :
contig_10:229705- 231402
Transcript NameFunction/comments
g3466.t1ETM41731.1 hypothetical protein L914_12519 [Phytophthora parasitica

Sequence
1697 bases(100 bases per row)
GGCTTGAAGGTGTCGCCGGGCCACGTCGCGAACTCGCTGGCCTGCAGCCACCAAGCCGGGTATCCGATCGAGGCCATCTGGTCGGGAGCTTCGCCCGTCG
TCTTGTAGCCGTCGCTGTACTTGGCCACCACGTCCATGCGAGTTCCCACCACTGCGCCACGACCTGCTCCGCGAACTCGTTGCTCTGCGCTTGCAGGCGG
GTAACCAGCTCGGTGTCACTCACGCTACCAGAGTGACGCTTTTCGTGCGCCTCCTTCTCCATCTTGCGTCGTCGGGCAAAGGCCTCCTTCTGCAAACTGT
CGATCTTGCCTCGAATGTCGATGCTCATCGAGTTGTAGCGAGCAGACTCCAGTTGTTCACGAAGTTGAAGGCCCACCAGGCAGACTGCGGGTTGAACTTG
CTTTGTTGGCCCAGCAAATACGACTTGGGCACATCGTGCTGCGCGCAGAGAACGGAACGAAGACCGAGCCGTGCGGGGCATCCTGAGCATACCATGCAAC
GCCACCAACAGCATCCGGCCCCTTGTTACTACGACTCTGCAGAACGAAGGCAAACAGCGTGCGGTACATCGAGATCGGTCGTTCCCAGCCGCCAATGACG
CCACCGGGGCTACCCGACCATCGCACAGGGGCTCCGGGGCCAGCAGCCAAGCCCTTGGTCATGTCGTAGCGCGTGTTTTCGTAGTGGTCGCGGAGTAGAT
CCATGATCTGGAACATCTCCACATTGCGGTCGGGCTTCACGGAGAACGGGTAGGTGGCGTACTGCGAGAAGCTGCCGAGACGGGCATCGAGCTGCAGCGA
CGGAGCCAGCACGTCGAAAACGCGCCACACGCGGCGTCCAGTGTAAAGCGGGCCGATGGCATCCTTGTCCGCAAAGCCGTAGGCGGCAGTGAAGTCGAAG
GGCTTGTCCCCCTTCGGGTCCCACCAGTTCATTTCTTCAGCAAGCGAGCGCACATTACTCGAGGCCATGAACCAGTCGGGCTGGCTCAGGTCGATTTCAC
GGATCGTGAAGCCGTTGGCAATCACCGTCACATGACCGTCAGGCACGCGCTGCGCTGCCCACACAGCCCAGCTTCGTCCTTGCCGGTCATGACGTGGAAG
ACCCAGACCTCACCCAGCTTATCTCCAACGACAAGCGCTTCAGCCGAGTCGCCGAAGTCTGGTTTCGCCATATCTCCGCTGTCTTCGCTGTAGAAGCCGT
ACTTCTCGGCCAGCGTCCCATGGTGCCCACAGCGCACGCGCAGTCGCACAGCGTTCAAGTGCGATCTTGGTGAGCTCTGCGATGCCGAACATGTTCTTGC
CTCCAGGCACATTCAGCGGCCACCCGGCGGTCTTGGCCCCGCATGTACTTTCGCCAATGCTGAGCTGCACCTCGTTCATCATGCCATAGTCCTGGTCGAA
GTACCCATACGTGTGCTCCACCTGCGGGACGTACCCAAGCGGCATCATGTACTCCTGCTCCACCTCTGCTAGTGGGTCGTGCACAGGCTGGTAGTGGGGG
CCACGGTCCGGCGCCACTACTCTCGGGTATCCGCCGTTGAAGTTGTAGACGGCACGCTTGCTGCCCGGCTCATGATCTTGCGCCGGAACGCGAACAAGGC
GCAGATCAGAGGCTGCATCACCGGCATCGTCCGTGTGCGCGATCAGCGTCGAGTTGTCTGCGCTTGCTCCTTGAGTCACAGCAATTGCTGTGCAGGC