Description :
From Genome Similarity Track
Location :
Scaffold_552:2297- 3698
Sequence
1401 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNATGTCGAAACACGATGTTGTACCTGGATCACACGGTATTGTGGTTGCTTCACAGCGTGACGATAACAGTCGACG
GTGTCATCACGAACGCACCACAagCGATAACAAACACTGGTGCATTCACGCCCTTTCACAGAAACGCTGGCAGCAGTACCATGGGCCGAGTCTGTCGTCA
TGGTCTTGTCGAGTCGAGTCAGCTCAATGTCATGAAATGTGGAGCTAGTACTTCGTGTCgCTGGTTTTGTCACTCACTTTCAATAATACTCAACTTGATC
CACGCAACTGCTATCACCATTACCGCGAAGTAGAAGAACGAGTCGGCTTTCAactGCacacAaacTtGCACACAAACTTGAAGAAAGTATCTGGCCGAAG
TTCGGTAACCGATGCCccAATGCACAACAGCCGACTGAACCATCATCCCCACGCGACCACGTTTCGATGTGTGGCAACTTGGTGgACTGGTTCCAAGTCG
ATGTGTGCGTTGCGCCAGCGATCAGCATCGCCCCGGATAGAGCACAGATCTGCAGTATCAATAGGAGCCATTCCGCATAACCGGACGGCGCTAGGCTACG
GCAAaGACGTTCCTTATGCCACAGTCTTTTGCACCACATCATCGgTtGAAaTCCCcATgAAAAAAAAAAAAAaCGTTTGAACAGCTCGATCGCGCCACAC
GACGGGTGCTTCACATACTTCTTGACCAAAaGTAAAaCATACAAaTCACCTtGGAGACGTCGCgCCGTGCCGCACACTTCGTGCTACCACACAAGCATCC
TCCCGCATCAAAGCgtCCCaTGGTCtCACTCGATTCTGTCTTGTGCTACAGACAATCAACCTTGTTTTCCAAGTCGTCCTCACGCTAGCTTCCACGACTG
CCTCTTCGACTCGGTGTCGTAAAGGCAGTGGCTTCTATCAACAGAATTTCTCGCTGAGCCTTTCCTTATCTTGTCACCAGAGACCCTCATAACTTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
N