Description :
From Genome Similarity Track
Location :
Scaffold_1:229687- 231071
Sequence
1384 bases(100 bases per row)
AAAGTTGTTTGACGCCCTACAATCGACTAGGGCTCGCAGTGAAATGTCCTTGCCACTTCGAGTTTCAAGTTAATGAGGTTTTCCTCATTACCAGATGCAG
TAACACACCATGGTTGCGTGTTGGGAGCAAGTATCGTCACGAGGCCTGCAAATTCACTTGACGTTTCTGGATCATTAGGGTGCTCCGCACCTACTGACCC
TGACCGTTGTTTGGCTGTCCGTTACAGTGTTGAGTTTTTGCAACAGCGTCGGACCCACGCGTCGGACCCTTCTTGGCCGCTTGACGGTTACCGTTCCTGC
GGTACGTGGTACCGCGTTCGGGGCACTGCATTCGTATGCATAATGACCTGTCTTTTGAAATCTATTGCATTTCTGCAATTTCTTATGATTGGTAACGCTA
GAGCTTTCGCTCTCAGTGTAACAGAGGTCCATCGGTCCTTGGCCTGAATTTCTTGTCGCCTAGGAGGATGATAGGAATTCGAACTCACATGAGCTTGTTT
TACGCTACAATCTTCCTATTCCACAACCTGGATTGCCTCTTCCAGGGTATCAAACTCCAGTCGGAAGAGTTAGGTCCTGGATAGACCATCCGCGAGACCC
TGCAGGAACAACGTAATTAACGTTTCTTCATTTTGCGGGTTGGCTGTAATGCAACTCGTAAGGTGACGAATGTACTGAATGTACGAGTGTACATCATATT
TGCTCTATTGAGTTTCCGGAGTTCATAGCGAGCCCTGAACTCATCTCGTGTCGTTCGAATGTTTGCCTAAGCAGGGAATTGAAGACTTTTAACAACCCAA
AGACAAATGGGTCGTGTAGCTTGATGCCCAAGGCCCAAGTCTTTGCACGTCCTGCCAAGTTCGATGAGCAAATGCGACCTGCATTTGCTTATCGACAATG
TGACGAGCCATTATGGCGTCATCTAGTTCGACAAACCATCACAAAATAGAGTCTTTATCCATCGTCTCCTTAGTATTTGGCGATGTCAATATTCATCGAT
TCGGGTCGACGCGTGTGTGTCGACCCAGTAGCAGCAGCATGCTGCTGTTCCAGCAGATAGAACTGTTGAGCACTCTGTTCTCTCAACAGCTCTGGCTGTT
GAGACCCTTGTTGGTGAAGCAAGGCTACCTTTCTTCTTTCAGCTTAAAGATCATTCTGAATGATCTTGGCGATGGTGGCGTGTTGCCCGTCTGGACCCAG
AGCGGACAGCATTACACCTACGGCTTCTTGCCCTATCGTCGAACTCAAACGCTCGACGGCATCCCATTTGATTTGACTCAAATGGAAGTAGCTCTCGTGC
GTTGGATGGAAGTCTTCCGCTTCACAATCCAACATGTTCATTTTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTC