Description :
From Genome Similarity Track
Location :
Scaffold_3:2296107- 2298518
Sequence
2411 bases(100 bases per row)
GCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACG
GGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACAATGGCAC
CCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGA
CTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGACTC
CCTTCCTCATCGCCACCGGCTTTGGGAGTGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCGTGATCACTAG
CGGACGACTGCACGCTGTCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCTCGGACTCGGCATC
GTCCTCACTGCCCGAGTTGAACTCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTG
TCCGCAGCCGCGTCACCCGAGGATCCGATAGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCCT
GCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATGTTAACGGTCGAAGTGGAGACCTTGACGAAGAGCGC
ACAGGTTGCTGCTCGAGGCTCTAACTGTAAAGTGAGCCTCCGCCGCGCTCGCGCGGCCGAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGA
ACATCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCACTAAGTGTACCCTGGTTACATGAAGTGTGAC
ACTTCACACTTCAGGAGTATGACATGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCATTCAAAACCAACCATTGGTTAAATGACATTGCATTT
CTATAGGTAACTGATAGTTTGTATTAACCACAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAA
TTAAAGAGGGGACCTGTGAGCTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTGT
CACATGTATGTTCATGTTGCATTTGGGTGTGCAGTTCGTTCAGTGTATTCTCCAGCCTGGGCATGCCTATGTTTTTCCTGAGGCATGTGGCAATCCACTG
CTGGAAAGCGAAGTGTTTAAGGCTAGGGTTGGCTAGGTGGTGCCGAGGGAGATCGGCTTTCTCGTAGATAGTAAAGTGTTTGCGCGACTGCTGGGAATTT
CTTAAGTGGGCCACGTGGCATTTATTATCCTATAATACGCCAATTTCTTTTGTCTCTCTTATACTATCACAGTCTTTAAGCAGATGTGGCTTGATTTTAT
TGTGGGATAATTTGGGAGTGGATCAGACCGCTTTGATATTTGTTTTCCTCTTATACTGTACTCGGTGCCGTATTGCCGGAGCTGTCTGTATCGCCCCTTC
ATGCACAAATTTTATGGACACAAAAACCAAAAGCACACAGTCGTGGCTTGTTTGGGAGATGAGGCTATGAGCAAACTCCGGCAAGTCATACGAGGCATAC
CGATTGTGATCGTGCGATTAAGAACAACACAGGCTCTGCGAAACGTGGGTTTAGGGGGGGGTATACCACTCGAGGATGGATTTGGCAAGGAGATGCGACA
GATCGACAGGTGCAAAGATCAGTACGGGCAGCCTACGTACGCTCGGTTCAACAAAATGTTTCCGTCAATACACAAGGCCTTAGCAAATAGAAAATTCTTC
TTCAAAACCCTACGCATTGCTTGTCACGTTCCTGATGATCCTAGCATTGTTCCCCTAGCATTGATCAAAGAATTCGAGCTGATAAAGTGTGATGCAGCGA
AGAAGGACAAAGCGTTAGAGGGGGGGGTGTCGATGAGTGTTATAAAGACACTCTTAGCCTTGCTACGATCGCGCCGCGCACCGCTGGCTTACAATGGCTT
TGCAAATATCCAGCTGGATCACTTCATACAAGCTTCGAAGAGCTTTGAGACCTGAAGCTGGCTCCAGGTGTTTACGTGGTAGGTGCTTCGTGGGCGCGGC
ACATAAAGCAC