Description :
From Genome Similarity Track
Location :
Scaffold_2254:2296- 3588
Transcript NameFunction/comments
Phyta_totarag14293conserved hypothetical protein

Sequence
1292 bases(100 bases per row)
CGCGAGAATGATGCGTTCGTATGACGCGAACTGCTGATTGACTTCCGATATAGTTACCTCCAGCTTCCGCACACCGCGCTCCTGCAAATGAATACCACCC
GAATAGGTTAGCAACCACAGCAAAGATTGCAATCCATGCCAACTGTTGGTTACCAGGAGCGCATCGAGTGTGAATGCGTCCACGAGCCGGTTGTTCTGTT
TGAGACAAAGTCAAAGCCATACGCGTTAGTATTAACTATGGCGGCTCCATTACAAACAAAACTGTGCCGCTCGTACAATGTAAATGGCGAGTTCTTCCGC
CGATGAGTGTACAattggcagcagcgagcagtcCGCCTTGGGGAAGCTGGTAAAAAACGAGTAAGAGACCAGTTAGACTTGTTACCACACCACCACAATC
CGGGTACAGACACAAGGCTACACACCTGAACCTCGCCATATCTTCCGTGACAATGTGTATATTCGAGTCGTCAAACGAAATCTGGGGCACACCAAGTCAG
CATTCAAACCGTCAATCCAAGACTCACAACTTCCTACCACCCCCGACTCGGAATTCCCATCCATACCTCCAGTACATCGCTGTTCATGGGCACAAGAAAA
GATTCGTTCAGGTCCTTGCAGATCACTCGCgagatcttcttgatctcaCCAAAGTCTATCACATAACCGTCTGGGCCGACCTGTCCCGTAATAGTGACGG
CCAAACGATAGTTGTGTCCGTGCAGTTTCTCCCGGAATCCCTGCAGACGCAGCCAAAATGCTCAGTACCCCATCCAGCACGACATTCAACTGACAGCCAA
AATGTATTATAGGCATCTCACCTTGAACGCGATGAAGTGCGCGGCATTGAACTTCATGAAGTCCTTCGACACGTGCACCTTGACCATGTTATTGTAACCG
TTGGTCACGAGGTTGGGCGTAGGTATCGTTGCCGCAACAGTAACAGTCGTCGGGGCGTCGATCTTTGACGTCTGCTGCACAGATTGGACGTTCGTTGGTG
CCGCTTGAATCTGCGCCCTGATATCCGCCGGCATCTTGACGCAGCTGTGTACGTGCGACGTCCAGCGGTTGACATTGTGCGTCGTGTTCTCCTTGTCGCA
GTAGCAGCACTCTTGGCCCATAGTTGATCCGGTGGAGCTGTGCTAGCGTCGCTTGGTGCTCCCGTTTTCTGTTGTGGTTTCTTTCAGCTGGGGGATGGAG
GTCTGAGCTGCCTGCTCGGCGATTTCCTCCTGGACGAAGCGTCTAATCTAACCATTGTCAACGGACATGAGCTTGAAgtgaagctctggatg