Description :
From Genome Similarity Track
Location :
Scaffold_233:22958- 24257
Transcript NameFunction/comments
Physo_144669retrotransposon element

Sequence
1299 bases(100 bases per row)
TACCTGCGATTCGAGGAGCGGAACCGGCAGGCTCTCTGGGAGGCCACTCATCACCTCCCGATCACCGGTACCCAGCGCGATGCCGACCCCGTCGTCGATC
AGTACTATCAAGAGCGTCGAACACGGCGGATCCGTGTCGGTGATCGGTGGCGGCAACTCCTCCACGATGTACTGCCAGTGATGCGTGATATGTGGGCGGA
CCTCGATCTGCTGCTTGATCCGTTCTTCCTACATATCCCTGTTCATCTGCGGGACTTCGGTACCTGGTATCCTGGCGTGGTATCCCGGGCCGCGAACGCC
GGCGACCCCACCCAGCATCAAGGTGAGCCGACCGACCTTCGGACGGCTCTGATCGAGGCAGACACCCACGATCCTTGGCGAAACCAGTACCGCGATCACC
CTCACGACCACCCATCCCGGCAGATCCCTCGTCTTCGCTCAGTCCACTCGCACGATCGGCTCCAGCGATCAGCCTGTCGGTTAGTCAGTTCACCCGAGGT
CGTAGTCATTCGGAGGCCGATCCTCTTTAATCGTCACCCGACGTCTTCCGATCAATCCATCCCATTGCAATACTTCATTTTCTCCGCCGAGTGTCAACAG
TCTTGGATCAATCCACTTATTCCAGCACGATCAACCAAGATCCACTATCATAAGACCTTGTCATCGCTCCGTAACCTTTCAATCTGCACTCTCATGCACA
CACTCATTCGTATACAACCCCTTCCTTCGATCGACGGCCTCCCCGTCGATCCGTCATCCATCTCGCTCACCAAGGCGACCAGCTCACCCTGGCGGTCCGA
TCTCACTCTTCCTCGTGAGACTGCATCGCGCTGAATCGGTTCCGGTTCACGCGATCTCAAAGGAAATCGTACAATAGAGCTCCACAGTTGAGATCAGCCT
CGTCAACCCAGTCAGGCTCGTCATAACCCTTCCAGTGGGCCCAGCTGTCCTCCGGAAGTAAGACTTCGTCGAAATCAAGTCGATCTGCTTCGTCCACCGT
GAGCGCGATCTGCGGTCGGTCGGGGAAGTCCCTGACCAACTTCAGCTTCGAAACATGCACGATCGGGAACAGGTGATAGTCCGTACCAGCGATCTGAAGC
TTCATCGAGTACTCGTTCACCTTCTCCGCAACACGGAACGGGCCGTGCCACAGGTGAGCCAGCTTCCGGGCATACCCCTCTTTCACACGATCCAGGTTCA
GCCACACCTGAGATCCAGCCTCGATCGAGTGCGGTCGAACTTCTTCATTGTGTCGATCGGCCCGATCCGCGATCGCCTCGCGTAGGGGAGCATTCACCT