Description :
From Genome Similarity Track
Location :
Scaffold_501:2295- 6931
Transcript NameFunction/comments
Hyaar_Emoy2814235reverse transcriptase

Sequence
4636 bases(100 bases per row)
GAAGGCAGAGACGATCTCGTGCTGGCCCCCGTTGGAAGCGGATACTGCAGCTGATTCTTCAAGATATGATCGACGGCCTTTGCGATTTGGACATTTTACT
GGACCCCATGTTTCTACACTTTCTCCGTCCGAATGAAGCTAGGGTGTGGTATCCCGGCCTATCCGTGCGGTGGACCAACATACCCAACTTGATCACTGCT
TTGTCGATCAATCACGCTTCCGAGCGTTGGAGGAACCAGTTTCGTCGTTCGATCGCATCCGACCCTGGATCGTCTCTTCCAAGCTTGGGTGGTAAGTTCT
TTGACCGCGAGTGATTTACTTGGTCTGTTCCATGATGCGATCTCTCAATCTACTTTCTTCTCATTTCCATTTGGTCGCTCCCATCATTCGTATTTCTTTC
ATCTTTTTTTGTCTTTTCATCTTGATCGCAGCATTAAGTCTGCGATCGTCGCACTCAATTCACATAAATCCCATTCCATCTCCATGTGCAACTTCCTTGC
ACCCATAACTCTTCTCCCCGTCCATGCACCGTCCTTGCATAGACCCGTCCACTCAAACTCTCCGATCATCGCTATTCTCTGGCTCTTCCTCGTGCGATTG
CATCACATCAAAACGATTCTTGCTCACCTGATCGCAATCGAACTCTTACAGCATAGCTCGAAAATTTAGATCAGCTTCGTCAATTGGGTCACTGTACTCC
TTCCATTGTACCAGGTACTGCTTGTGTATTCGGCCATATCTCGTCTTCCGTCCTGATCGCACATCGATGATCTTGTCTACTTCAACTCTTCCGCGTCGAG
ATTACCCTCCCAACTATCTTCCGGCAGCAGTGCTTTATCAAAATCAAACCGAATTGCCTCATCCGCATTTAATCCACCCGTTGGGCGTTCTGGGAATATG
CGAACTAGCTTCAGCTTAGACACGTGGAATATTGGGAATAGCCGGTACGGCGTGCCGGCGATGTCCAACTTTACGGCGTGATCGCCACACTTCTCGGCCA
CTCGAAAAGGCCCATGCCACATATGGGCTAGCTTTCGAGCATATCCTTCCTTGACTCGGTCTAGATATAGCCAAACTCGCGACCCGCGATCGGTATCCAA
TAAATATCGATCTTCATTATGTCGATCGGCTCGACCTCTGATCGCAACCTTCAGTCGTTCATTCACTACCGCCCGAGCACGTTGATATTGGCGTTGCATA
CCATATCTCCATTTTCGGGCATCTCGATCCCGGGGTTTGGTACTTCCCAACGGTAAGGTTGCTTCCAAAGTCGATCTTGGGTCCTAATCGTGAATCAGGT
AGAACGGTGTATGTCCTCGAATTCTATCATGAGCGGTTTTGATCGCATAAGTCAATCGCGCTGCGTATTCGTCCCAGTCCTTTTGATTTTCATCCATGAC
ATACATCTTGATCGATCGAGTCAGCGTCTGTACCATGCGTTCAGCCGTACCATTAGCTTGCGGTCTATACGCCATAGTGGCCCGTTATTTTTGTCCCGCG
ATCCGATTGAATGCTCGGAAGAAATCAGACATAAATCCCGGCTCGCGATCATGTCGTATCGCCTCACTCGCAACGAATCGTCTGAACACGCACTCCTCGT
AATTCTCTGCGATCGACTGGGCAGATCTGGACGAGCTTGCCTTTGCGATCACATATCCTGAGAAAAAATCTACCCACAGCAACAGTTCGGTGTTTCCTTT
AAAGGATCTTGGCAACGAAGGGATGTTATCCATAGCTATAATCTGAAAAGGGTACGTCGATTGCATATTACCAGGTGATCCACTTCGATCCCCCGGCCGT
CCTTTTCCCGTTTCACAATCTACACATTCTCCCACATGCTGCTGCACACTTCGGTACAACCCACGCCAATGGAAATTCGCCCTGATCCGTTGATAGGTAC
GGCATATTCCTTGGTGACCACCCTCCAAACTTGTGTGGTAGTGGTGCAAGAAGTCTCGCTGTAACTGTTCTGGAACCACCAAACGAGCCAGTTCAGTACG
ATCTTCAGCTTCGGTGGCCGATCTCGGACAGAAGAATAGCAGCCCACTTTGGTCTAATTTATAGTCCGGTGCGATCAGGGTGCACACCTTATCCTCAGCT
GCCGAAAATTTAGCTACGTCTCCAACCAGATATATCTTCAAACTAGATATCCAGTTTTCTTCGTCTTGTGCTTGCTTAATACGACCAATCCGTATCTGCT
GCACAACCTCTTCCTTTAAACCCTGGGCTGACAACGTCTTCTCTGGGCTGTTCGAGTGATAGCCGCTAGTTTGATCGCACGATCAACTCGTTCTGGTAGT
AGTAATTCGTTTAACCGATTGAGAGTAATCAGGTCCTGACGCTCTTGATAGGAAACCACAACTGTCCCTTTTTCTTGCCGCAGAGCTTCACTCTCCAATC
GATCTGCACTCTGATTCTAGTCCCGCTTCATGTGCAAGAACTCGTGGGATGGCCACGATCGTAATCTCTCCATAGCCCTATGCCTCAGCAACTGCAGTCC
CGGCGATTTACAGTCGATTTCTCCTCGCATTTGACGGATCACCAAATTCGAATCTCCGCAGATAATCACCCGTCCCCTTGCCTGATCGGCAAGCAAATCG
AAACTAAGGAGCAGCCCTCGGTATTCTGATTCATTCATGGTTAGATCAGGGGTATACTCGGAAGCAACAGCCACAATCGTCCATTTCGGCACTTTTCCAT
GTACTCGCGCTGTATGCTCCGTCCTTTCTTTTCACCCTGGCTGATCCATCGAAACTGGCTACCAGCATGTTTTCATTCACACCTACTGTGGGTGGTGACA
TGCTTATCGTCTGTCTTGGCTGCTTCCTCGGGGCGATCGCAATCAATACTTCATCTACTTCTTCACGAGGTGTTATACTTGCCGCAAGCATGCCGAGTAT
TTCATCTTCTCCCTTCTCAAATCGCCTAATTTCCAACGTCCAGTTCGATAGTAAAGCAGCTCATCTTCCCAATCTTTCGTTGTGGCTTGAAGATTGTAGT
AACCATGCTAGTGTCTAATATCGCGTAAGCACCGTAATCTCACGGGATACTAGCATAGTATAGCAGATGTCTAGCATCCGGAGGAGAGCCAACACTTCTT
TCTCCACCGCCCCGTAGTTGACTTCGTTGGGCCTTAGCATACGACTAGAGAAAGTGACAGGCCAATACACACTATCATATTCTTGAAGCAGAGCAGCTGA
TACAGCCCACTTACTAGCATACACCACGATTACAGGCGATCGATCGGGATCGAAATGCTTTAAGATTGGAGTTGTGGCTATCTTAGTCTTTAGCAACGTG
AATGCAATCATTGCCTTCTCCCATCGATTCCTGCCCTCCGGATCGCGATCGTCCCCTGCAATTGGGTATAGATCGACATTGATCTCCGGTTTTGGGTACA
GATCACGATCGCCCCCTGCACTCCTTTCGTGAATAGCATCCGGTCTTACAGCAGAGGTCGGTTTTGGAGCTTCACTCACGCGGTTGATCTCATGGAAATC
TGCTTCACGCAGTTTGTACAACACTGATGCGTAAACTGCGAAGTCTTCAATGAATCTACTGTAATAGTTGAGACTTCCCAAAAATGACTGCATCGCTGGC
AGCGTCCGAGGGAACGGGATGTTCACCAACGATCCCAGATCGTTCCGGTTAGCTTCCAAACTAGCGAGCGATATTTGATGTCCCAGATATTCAACCCTGC
AACGTCCTCAAAAACGTTTGGCCAAACTGATCGACAAATTCCACTTATCGCACACCTCCAATAATCTCTCCGCTTTCTCATACAGGGCCTTCCACAACGT
AGCTGGTATTAAAATGTCATCAATACAAGATCTTCGACCCAACACTGATGGTTTTGGATCAGTATCTGGTTCACCATCAGTGAAGACATTGATCAACTTC
GGCGATTCCGCCGTGGTCGATTCGGATTTTACGCCGATTTTCAAATACCCATACAGAGCGTTATCGATCAAACGTTGGTAGATCTGTGGAGCATTTTTCA
ACCCGAAAGGCATCCGCAACCACTCTAACAACCCTGATGGTGTGATAAAGGCGGAAATCGCCCTTGCTCTTTCCGTCAACTCCACCACCCAAAAACCACT
CGCCATGTCCAGAGAGCAGTACCACATAGCTTTATCCATGTCTTGCAATAGTTCGCTGATCAGTGACATCGGATACACCATCAACCTAGTCAGCTGGTCA
CCCGCCCGTATTCAATACACAGCCTTATGTCTTCTCCGTTTTTCTTGATGATCACCACTATGGGGGACACCCATGGTGATGTAGACGGTCGAATGATCTT
GTCCGACAGTAATCCCTTGATCAGATCGGCGAGTTTTTCTCGGAACTTTGGTGCTACAGGTCGGACCCGTTGTGCGATCGGGTTAGCTCCTCCCACGTCG
ACGTCACAAACTGCCCCACGCGCCGCAGGAGGTAGGGCGTTACCCTTTCCAATAAGTAGATGCCGGCTCTTCCAAATCGTTTGGCGCAACTTCTCTTGAT
CCTCGGTTCTTGGGGTGCCGGGATCGCCTACTTGAATATCATCAATCATTATTTCTTGTGTGGGCGTACCCACTTCGGGAAGAACTACCATGTGCTGATC
CACATCTTCCGCGAACAACTCGCCACCATCATGTAA