Description :
From Genome Similarity Track
Location :
Scaffold_1689:2295- 6083
Transcript NameFunction/comments
Phyag_g11269hypothetical protein PHYSODRAFT_320732

Sequence
3788 bases(100 bases per row)
CATGGCGTCGGTACGGCGCTTGCTCTTGGCTGCAAACTTCGACGAAGAGTGCGACGCTCTTCGTCACTTAGTGAAAGTTCAAGAATCAACTACTGAGCAC
CACTTCGACATTGGGCTTTTGAATTGTGAACCTCCAGTTCTGCTACATGACGGGGATGATGAAGGCCACAACAGCTCCCAAtcgttgctggaggatcTAC
TTCTTTACTTGATAGTGCGGGAATTTAAGGTCACCGTTGATTCTGCTGGAATCAAACCAATTCTAGGCATTGACCAGCAGACTTTGGCGAATTGGGAACG
GCGTGAAGTACAACAGCATACAGAGCTAGAGAACCATGTCGAAACATTGCATGGGTACGTTATTAAGCATGTTTAACTCGGTTCTTTTGAGAGGGAAACT
AAGCCGTGATTGCTGTTTCTGTAGATTTCTGCTGAAGAGTGAGTGGAATTCAGCCACAGTTTCCACTCTCAGTCGAGTGGTAAAACGGTTGCAAGATCCG
CGCGCTCGCCAACACTTTTTAGCGTTCGCTTTTCAAATACTCCGACTGTCATCCCAACCAAAAGAGACACTACACGTATTGAAAGTGGAAAGTGAGGACA
AATTTTTCGATGAAGCTGTTCGCCTGTTGTTACTTGGTGTGACGGACTTGTGGTCTGCTATCCGAAAAGACTGCGCTAAAACTGCAGCCGCGATTGCATT
CGAGTTTTCATCGCAGTGTCATATTGAGCAGTTCATGGACAGTTTACTCTGCGTAGCGATCGGGTCCCGTAGTGTTAGTGCTGACAAAAGCCAAGTGACT
GCGTGGACCGAGAGGGAAGGCGCTTTGCTGGCGCTATCGACTCTTTTGCATTCTGTCAAAATGGAGTCGACCGACCATCAATTGGAAGATAACAAAGAGA
CCAAGATTTCTCAGGTTAAGGACGATATCAAAGGCTTATTGGGCGCCCGTCAATTTCCAGTGACGAGATACCATCTTGGGTCTAACGGGCGCCATACGTT
GACTCAATTGCCCCGTTGTCTTATACAGACGCTGAAACCTGCGATTTATCACTGTCTTCGCCACGACCAGATCAGTATCCGACAGCTTGCAGCTCAATGT
TTGGTAGAATACGTTTCCCTTTGTGAGGAACCAACACGACTACTTACTTTCCAGGAAGTAATCAGCAAGCTGAATCGTATGAATCGGAACGACAATGTGG
GGGAGAATGATACTGCTGAGAATCCCAACGAATCAGAGCTTTTGGATGCgttcgaagctgaaggaTTGCTGGATGTGTTAGCTCGGATGGTGCCGTGTCT
TCCTTCAAGCTTTTTGTTTAAACACTGGAAGTTCGTATTTCCAACGTTGGAGAAATACGTTATCCACATCGCTTCAAGTGTTCGAcagaggagcagcagc
gttgtGTTGGCGCTAGCTAAAAAGAGCACTAGTAGTATCAACCACGGGCCGGATGAGTTAGTGTCGAATCCGGCTACAGGTTTTGATGAAGCCGCCTTGA
AGTTGATGGTGCAAATGCTATTGTCTCTATCTaagcagcgagaagatggaaGCAGTTTCTGTTGGCAACAAAAAGAGGGTCGTCTTTTGAGCATTGATGT
TCTCATTAACGTCCTGGGCGAAAGCCTCAGTGATTCCTGCAAGCTGTTGAGGTGGAAGCCAGAGCTGACCAAAGTTCGCGAGCGTCGACCAGGTTCGTTT
TCTGATTTGCAGTCAATTCTTTGGGCGCATGATCGAATTTCGGTGGCTACATGGGTGTTCAATCCAGACGAAGGGGGTCAACATGCTCAAGAAACTGGTG
AAGGCGGCAAAAATGAGAACAAGTCACTTGCCGATGTTATCAGCGCTTGGATAGAGAAGAATGGGGTTCAAATTGACCTACCTTCCTCAAGTCACGGATT
CTGGCAGCACGTTCTGAGCGGGTGCATCACTCAGACAAAAGAGGCCTTCGAGTCGTCCCAGTTTGAGCTTCGCAGAATCTCTCGACAAATTCTTCCTAGT
TTGATGAGGCTTGTGATTTGGACAGACCAGTTGAAAATTTTCTCGTCGACGCAGCTTGAAAATGCATCTTCAGAAACaccatggtgctggacgtgcaTGA
AGTATATTTTACTCCACTTGCGCTATCTGGAGGAGAGTAAGGCTTTATTGGGTGAAAGGTCTGAGAGCCCTACCTCGCAAAAGTTAACAGCGGACTGGAA
AATCGTTTGGAATGGCATATTGGCCTTGGAAAGTAACGAGCAACATGTCTCCGTCGATACAGAAGCTACAGCGGCTAAAGTGGAAGTAAAAGCGATGGCG
TTCCTTAGTTTTGGAGCGTCGGCAGATCCACCACGTCAAATAACTTGGCTTATAGACGGTGCGTTGCGATCGATTCACAAAAACCTACCAGAAGAAATGA
AGCTGCGAACACTATTGGCAACAACCGGTCCTAACGATAGTTCTCTTGATCGGCAAATTTGTGTTTTCCTGGTACCTATCATGCCAGCGATTGTCGCCAC
TTTGCAATACCTCATTGAACAGCATGGAAGTATTGGTGTTCGATCTCGTGAAGCCGACCTATCATGGAGTTCTCGGTGGCTTTGCCTGGAGCGGATGGCT
TTGGTGTGGCTATGGTGTGATGATATGTTCCGATGGATAACACTAAACAAGTCGGAAGCTCAATCTCAGCTTTTGGAAAGTCTTCGTGTGCTTCTACACT
TCTCAAAGACCGGTCTTTCGCAAACAGAGGaggttgaagaagctgacaaAATTGTTCAGTGCTTAAACGACACTTTCGGTGCTCCGCAGGCAAAAGGTGT
CCGAGTAAAAGACGCAATTTACATGCCCTTGCTAGATATTTATCTGCAAATTTGGTTGCGGTCTATCAAGAGCGATAGCCGGGTTACAAACAAGGTGCTT
GTTGCCATTACCCATCTTTACTGTCAGCGACAGCAATATGATGCTAATGCAAAGCCCGCCGATAGCGGTTCGACGTGTCCGGCAGTTGTTTCGTGGGCCG
AATgggatgacgaggacgagattCAACTGGCAACCCCAGTCGAGGATATGCAAGAACCCCACAGATCGCCCACTTGTGACTCCATGTTTCAGGAGGTGCT
AAAAAGTCTAGACTCCAACCAGCTAAGTCAgttctgtgttgctgtgcgtGGACTCTTCGATCTACCTAGTGCGCGCGATATCCCCGTCCAGCATATATCG
CGAATGCAGCAACAGATTGAAACTACTCTGGGCTCTTCGTAGCGCTGTAGACGTATATTCATCGATGCAAATTCTTTCGCTGCCACTACCTAGTTGCCAA
ACTCCAAACACAATGCAGCAGTTTCCACCAAGCTCCAAATGCAATGTGCTAGTGTCAGGATCACCACCAGTACGGGCATCATAATTTCCCATGTCAGCGT
TTCTTCAAACACCACCTCTGCCCTCTCAATCAGCGTCTCTGCTGGGGGACCCATGTTCTCCTTTTCATCATTTTCAGCCTTCTTCTCATGTTCTTCAGGT
GGTTTTTCCAGTCTCTCTCCAGATTCTCGGAaatcttcatctccactaCTTTCATCCAAAATACTCCTCTCCGGGTTGTAGTCGCTTGCGTCGAGAATTC
CACCTTGTGGCCCATCATTCGTGAAGTAGTCCATGATAATTTGATTCGACAAAGAGGCTTCATCGTCAGGGAGCAGTATCACTGTGCCCAGAGCTTGGTC
CGTCGCCGTGTTTTCGTGCGTCGACATCGGGGAATTGGTGATCTGCTGTTCCTGTCGGTCGAAAGCAGTCAGCGACAGTTCTAACCGT