Description :
From Genome Similarity Track
Location :
Scaffold_5:2294659- 2322643
Transcript NameFunction/comments
Physo_508218Hypothetical protein
Physo_507584PREDICTED: probable nitrate excretion transporter 6-like
Physo_507614D-arabinose 5-phosphate isomerase
Physo_335014Eukaryotic/viral aspartic protease, active site
Physo_249123Hypothetical protein
Physo_391932putative signal transduction histidine kinase
Physo_511536Hypothetical protein

Sequence
27984 bases(100 bases per row)
AAGCGACCGTGTGACGCGAACGCGTCATCAGTGAAGTCGGCGTGACCTTCACTGTGTTGTACCGCAATCATTCAGGTGATTACGGGACGGTGATTACGCC
AAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATTAGTGATATAGTACATTACTTCTAAG
CATAAAATAGCAATCCGCGCGGCTTTGAGATATAAAGCAAATCAGTTTACGGTTACCAACTCAACAATCATGCAGACTTCGGAGCTTACTCAATGGAGCG
ATCTTGGCTACAATGATCAAGAAATGATCTGCCGGTTTAAATCTCTTTCAGTGGAGTTTCTTCGTGAAAACATCCGCCCTGGTGATCTCGTATGGGAAAC
CATTTTGGCATACCAGAACCTCTCGATTGAATTTATCACTGATCACATCGAAGTGCTTCCACACTGCTTTGACAAGTGGGGGCAAAATGGATGAACGATC
ATATCCTTCGGTCTGTCACACCTTCCTTCCATATAGCTTCATCAATCAACACAGCGATAAACTGTGGATGGGGTCGGAAAAAATTCAGACTGAAGTGAAC
AACCACAAGCGCATTGAAGTGGAAGCCATTTTCGAGACGGTGATGCCTGAAAAAGCCATAGCAACAAAGATTGCTTCATACTATGTCTGACTGCTTCTGT
TCATTGATAACAAGGTAGATACTGTTGTCAAGACTGATGTGACGACGCCTCGCCAAGCGACCGTGTGACGCGAACGCGTCATCAGTGAGGTCGGCGTGAC
CTTCACTGTGTTGTACCGCAATCATTCAGGTGATTACGGGACGATGATTACGTCACGGTGATTACGCCAAGATTGTGGGTACAAGATGGGCATCGACGTG
GCGTTCTCTGATTGGATAAGGTAACTGTGTATCCAGTAGAGAATCCAGTAGGGTGTATCCAGTAAGAGGTATCCAGTAGCAGGCTTAGAGGTAGCACGCG
GTTGCGAACTAAGGACCTGAATCGAATCACTTTGCATTTTGCCAACTACTGCTCAAGTGCTCTTCCTTTTGGTTATGAGCCCAAGCCCCGTCTTCCCTGA
CCAAGACCCCGACTACGCCTTCGCCATGGACGCCGCCCCGACCGCGACCGCCCGCATCAACAAGTTCGACGGAACCAACTTCCACACATGGAAGTTCAAG
ATGCAGATGGTGCTGGAGGAGCGCGAACTGTGGGAAGTGACGAGTGGGGAAGTGAAGCTCGAGCAGTGCACGACCGCGGCGGACCAAGCGACGTTTCGCA
AGAAGTCGCGCAAGGCGCTGGCGATCGTCTGTCTCGCGTTGGAGGACTCGCAGCTGCCGCTGGTGCGGTCGGCGAAGGATGCGCATGATGCATGGTCAAG
ACTCGAGGGACACTTCGAGAAGAAGAGCCTGGCGAACAAGCTCTTTCTTCGTCGACGGTTCTTCACGACAACGATGGACGAAGGTGATGATGTGCTGGAG
CACATTAACAAGCTCAAGACGCTGGCGGAACAGCTCGACGCGGTCGGCGCTCCGGTCAGCGAGGACGACTTGGTGATCACGCTTCTTGCCAGTCTGAGCG
AGTCGTACCAGTTCCTCATCACGGCGTTGGAATCGCGTTCCGACACGCTGACGTGGGAGCTCGTGACGTCTCGGCTCCTGCACGAGGACATGAAGCGCAA
GGAACAAGGTGGTGGTGCTGACGGAACCGCGCACGCTCAAGGTCAAGCGTTCATGACAAGCGACAACGGGAAGCGCAAGGGACGGCAGGCGCAAGCGCAG
AGGACGAGCGCCTGTCACTACTGCGGCGAGCACGGACATTGGATCGCCAAGTGTCCGGTGCGGATCCGCGAGAACGGGGAGCGGCAGAGGCCGCAACGAG
CGAACGTCGCGCAGGTCGAAGATGACTCTGGCGACTTCCTCTTCTCGGTTGGTGGCGACACGGGTGCCTCCAAGCTGAGCGGCATGTGGCTGGTCGACTC
GGGTGCGACGCAGCACATGACGTACTCGAAGGAGTACATGAAGAACTACAAGAAGATCTCTCCGGTGGACGTGCATCTGGCGGACGACGGCGTGGTTCAG
GCGGTGGGGAGCGGCGACATCGTGATGTCGATGCAGACACCGCGCGGCATGAAGAAGGGTGTGCTCACGGGTGTGTGGCACATCCCGAAGCTGTCGCGCA
ACCTGTTCTCCGTCGGCCGCTTCACCAAGGACGTCGGGCCAGTGACCTTCGAGAGCGACGGGTGCTTCGCGGAAACGAAGGGTCTCAAGTGGAAGCTCGG
CGCTCGCGAAGGCAAAGGACTGTTCAAGCTCTGCATGACGCCGAGGACGCCTGCTGACGAGGCCAATGCGGCAAGCTCGAAGAATCGCCAAGGGGACACC
ACGTCGTACCTCTGGCACCTTCGACTTGGTCACATCGGCCATGGTGGTCTCGACGCCATCGTCAAGAAGGGCTACGGCACTGGCATCCCAATGACGTCGG
TGAAGCAGTGGGAGGTGTGCGACGGGTGCGCACTCGGCAAGCAAACGCGAGTAAGCTTCATGAAGTCGTCGCCGAACCGTGCGAAGCAAGTGCTGGAGGT
GGTCCACAGCGATGTGTGCGGTCCGATGCAGACGGCGACGTTCGGAGGCAAGCGCTACTTCGTCACGTTCATCGACGACAAGTCGCACTTCTGCGTGGTG
TACCTGCTACGGAACAAGTCGGAGGTGGCTGCCAAGTTCGCTGCGTTCGTCGCGTTGGCTGAGACGCAGACCGGCAAGCGAGTGAAGGTGCTTCGGAGCG
ACAACGGCGGCGAGTACACTTCGGGTGCGATGGCCAAGTTGTGTGCGGATCGCGGCATCGAGCAGAAGTTCACGCCACCATACACGCCTCAGCTCAACGG
AGTGGCCGAGCGAATGAATCGGACGCTGGTGGAGTGTGCGCGCTGCATGCTGGAGCACGCCGGGTTGTCGAAGGAGTACTGGGGAGAAGCGGTGATGACG
GCCACGTTCCTCCGCAACCGGTGTCCGACGCGCGCCATCAGTCACGACAAGTCGCCGCACCACGTTTGGACCGGCAAGAAGCCTTTGCTGGCCAACCTCA
AGGTGTTCGGGTGCCACGCGTACGTGCACGTGCCGAAGGAGAAGCGGTCGAAGTTCGACGCTCGGTCGGTGCGCTGTCGTTTCCTCGGGTACTCGGAGCA
CGAGAAGGCGTATCGGTTCGAGGAGATCGAGAGCGGTCGCGTGTTGGTGAGCCGCGACGCGCAGTTCATGGAGGATGTCTTCGACGGTGGGAGACGCGAC
TACGCTTCGAAGGAGGTGTTGGTGGGTCTTCCGACAGATGATGATGAAGACACCACGGATGAAGAGACTCAGTCCGGATCAGACGAGAACAGAGAAGAAG
CTGCGCGGAATCAAGACTTTGAACCCGGCAGCAAGCGACACCCGCGCACGCAGTCGCTCGAGGAAGCCGTGGAGGTTCCGAGTGCCAAGCGGTATGCGGT
GCCGAGACGACAGCAGCCGCTGGACGAGATGTCTGCCGCAGCACAAGAGAAGGAAGACTTCGAGGCTGCGTACGTCGTGGATTCAGTGGGAGAGATGCCG
ACAACGTTCAAGTCGGCGATGGAATCCAGCGACGCAGACAAGTGGAAAGAGGCGTGCGACTCAGAGGTGGAGTCGCTCCGCAAGAACGAGACGTGGACCC
TGATGCCACTGCCGAAGGGACGCAAGGCGATCAGCTGCAGATGGGTGTTCCGCGTGAAGGAGAACCAGTCTGGAGAGATCGAGCGGTTCAAGGCGCGACT
GGTGGCGAAGGGGTTCTCGCAGAAGTACGGCATCGACTACGACGAGACGTTCGCGCCGGTGGCCAAGTTCACGTCGATTCGGGTGTTGCTGAGTCTGGCG
GCCAAGTACAAGCTCACAGTGCACCAGATGGATGTGAAGACCGCGTTCCTCAACGGCTTGTTGGACGAGGACATCTACATGGCGCAGCCGGACGGATATG
TGGACGGAGATCGACCCGACTACGTGTGCCGGCTCAAGCGTTCGCTGTACGGCCTGAAGCAGTCGCCGCGGATGTGGAACAAGACGATCGACGAGTTCAT
GTTGAAGCTGGGGTTCAAGAAGTGCGAGTCCGACCACTGCATCTACTTGAAGCGGGACAATCACGACATGATGTTCGTGGCACTGTACGTGGACGATCTG
GTCCTCGCCAGCAGCAGCGACGGGATGCTGAAGGACACGAAGCAGGCGCTGAGTGACCGGTTCGAGATGACCGACATGGGCCAGCTCAAGTACTTTCTCG
GTATGGAGATCGAGCAAGATGTGGCGACTGGGAAGGTGTCGGTGCGGCAGACCAAGTTCGCGAAGGACATTCTCGAGAAGTTCAAGATGGATGAGAGCAA
CCCTGTGAAGACACCGCAGGATCCGGGTCTGAAGCTGACCAAGGCCATGTGCGAGGGAGGCTGCAAGCACGACGAGACCATGGCGAATGTTCCGTACCGG
AACGCCGTGGGCTGCCTCATGTATCTCATGGTGGGGACTCGTCCGGACCTCGCAGCGGCAGTGGGAGTGCTGAGCCAGTTCGCAGCGGACCCATGTCCGA
CACACTGGCAGGCGCTCAAGAGGGTCTTCCGCTACATCCGAGGCACGAAGACGCACGGCCTCGTGTTTCAAGCGAGCAGCGAGGACGGACTGCAAGGCTA
CTCGGACGCGGACTGGGCCGGCGACATCGAGTCTCGACGGAGTACGAGCGGCTACGCGTTCATGATGAACGGCGGATGCATCAGCTGGCGAAGCAAGAAG
CAGCGCACGGTGGCGCTCTCGTCGACGGAAGCCGAGTACATGGCGCTGTCGGAGGCCACGCAGGAGGCGGTGTGGCTCAAGGTGTTTCTGTGCGAGCTGG
GCGAGATGGCGAGCGATGAAGCGGTGAAGATCTACGAGGACAACCAAGGCTCCATCGCGTTGGCCAAGAACCCGGAGTTCCACAAGCGCACCAAGCACAT
CGACATTCGCTACCACTTCGTGCGCGAGAAGGTGGAAGACGGTCAAGTGGTGTTGCAGTATGTTTCGACACTCGACATGCTGGCGGACATCATGACGAAG
CCGATCGCGGCGCCGCAGTTCGACGCGCTCAGGACGAAGCTGGGCATCGTGGTCGCTGACGAGTCGAGTGGGAGTGTTGTCAAGACTGATGTGACGACGC
CTCGCCAAGCGACCGTGTGACGCGAACGCGTCATCAGTGAGGTCGGCGTGACCTTCACTGTGTTGTACCGCAATCATTCAGGTGATTACGGGACGATGAT
TACGTCACGGTGATTACGCCAAGATTGTGGTACAAGATGGGCATCGACGTGGCGTTCTCTGATTGGATAAGGTAACTGTGTATCCAGTAGAGAATCCAGT
AGGGTGTATCCAGCAAGAGGTATCCAGTAGCAGGCTTAGAGGTAGCACGCGGTTGCGAACTAAGGACCTGAATCGAATCACTTTGCATTTTGCCAACTAC
TGCTCAAGTGTTCTTCCTTTTGGTTATGAGCCAAAGCCCCGTCTTCCCTGACCAAGACCCCGACTACGCATTCGCCATGGACGCCGCCCCGACCGCGACC
GCCCGCATCAACAAGTTCGACGGAACCAATTTCCACACATGGAAGTTCAAGATGCAGATGGTGCTGGAGGAGCGCGAACTGTGGGAAGTGACGAGTGGGG
AAGTGAAGCTCGAGCAGTGCACGACCGCGGCGGACCAAGCGACGTTTCGCAAGAAGTCGCGCAAGGCGCTGGCGATCGTCTGTCTCGCGTTGGAGGACTC
GCAGCTGCCGCTGGTGCGGTCGGCGAAGGACGCGCATGATGCATGGTCAAGACTCGAGGGACACTTCGAGAAGAAGAGCCTGGCGAACAAGCTCTTTCTT
CGTCGACGGTTCTTCACGACAACGATGGACGAAGGTGATGATGTGCTGGAGCACATTAACAAGCTCAAGACGCTGGCGGAACAGCTCGACGCGGTCGGCG
CTCCGGTCAGCGAGGACGACTTGGTGATCACGCTTCTTGCCAGTCTGAGCGAGTCGTACCAGTTCCTCATCACGGCGTTGGAATCGCGTTCCGACACGCT
GACGTGGGAGCTCGTGACGTCTCGGCTCCTGCACGAGGACATGAAGCGCAAGGAACAAGGTGGCGGTGCTGACGGAACCGCGCACGCTCAAGGTCAAGCG
TTCATGACAAGCGACAACGGGAAGCGCAAGGGACGGCAGGCGCAAGCGCAGAGGACGAGCGCCTGTCACTACTGCGGCGAGCACGGACATTGGATCGCCA
AGTGTCCGGTGCGGATCCGCGAGAACGGGGAGCGGCAGAGGCCGCAACGAGCGAACGTCGCGCAGGTCGAAGATGACTCTGGCGACTTCCTCTTCTCGGT
TGGTGGCGACACGGGTGCCTCCAAGCTGAGCGGCATGTGGCTGGTCGACTCGGGTGCGACGCAGCACATGACGTACTCGAAGGAGTACATGAAGAACTAC
AAGAAGATCTCTCCGGTGGACGTGCATCTGGCGGACGACGGCGTGGATCAGGTGGTGGGGAGCGGCGACATCGTGATGTCGATGCAGACACCGCGCGGCA
TGAAGAAGGGTGTGCTCACGGGTGTGTGGCACATCCCGAAGCTGTCGCGCAACCTGTTCTCCGTCGGCCGCTTCACCAAGGACGTCGGGCCAGTGACCTT
CGAGAGCGACGGGTGCTTCGCGGAAACGAAGGGTCTCAAGTGGAAGCTCGGCGCTCGCGAAGGCAAAGGACTGTTCAAGCTCTGCATGACGCCGAGGACG
CCTGCTGACGAGGCCAATGCGGCAAGCTCGAAGAATCGCCAAGGGGACACCACGTCGTACCTCTGGCACCTTCGACTTGGTCACATCGGCCATGGTGGTC
TCGACGCCATCGTCAAGAAGGGCTACGGCACTGGCATCCCAATGACGTCGGTGAAGCAGTGGGAGGTGTGCGACGGGTGCGCACTCGGCAAGCAAACGCG
AGTAAGCTTCATGAAGTCGTCGCCGAACCGTGCGAAGCAAGTGCTGGAGGTGGTCCACAGCGATGTGTGCGGTCCGATGCAGACGGCGACGTTCGGAGGC
AAGCGCTACTTCGTCACGTTCATCGACGACAAGTCGCACTTCTGCGTGGTGTACCTGCTACGGAACAAGTCGGAGGTGGCTGCCAAGTTCGCTGCGTTCG
TCGCGTTGGCTGAAACGCAGACCGGCAAGCGAGTGAAGGTGCTTCGGAGCGACAACGGCGGCGAGTACACTTCGGGTGCGATGGCCAAGTTGTGTGCGGA
TCGCAGCATCGAGCAGAAGTTCACGCCACCATACACGCCTCAGCTCAATGGAGTGGCCGAGCGAATGAATCGGACGCTGGTGGAGTGTGCGCGCTGCATG
CTGGAGCACGCCGGGTTGTCGAAGGAGTACTGGGGAGAAGCGGTGATGACGGCCACGTTCCTCCGCAACCGGTGTCCGACGCGCGCCATCAGTCACGACA
AGTCGCCGCACCACGTTTGGACCGACAAGAAGCCTTTGCTGGCCAACCTCAAGGTGTTCGGGTGCCACGCGTACGTGCACGTGCCGAAGGAGAAGCGGTC
GAAGTTCGACGCTCGGTCGGTGCGCTGTCGTTTCCTCGGGTACTCGGAGCACGAGAAGGCGTATCGGTTCGAGGAGATCGAGAGCGGTCGCGTGTTGGTG
AGCCGCGACGCGCAGTTCATGGAGGATGTCTTCGACGGTGGGAGACGCGACTACGCTTCGAAGGAGGTGTTGGTGGGTCTTCCGACAGATGATGATGAAG
ACACCACGGATGAAGAGACTCAGTCCGGATCAGACGAGAACAGCAAAGAAGCTGCGCGGAATCAAGACTTTGAACCCGGCAGCAAGCGACACCCGCGCAC
GCAGTCGCTCGAGGAAGCCGTGGAGGTTCCGAGTGCCAAGCGGTATGCGGTGCCGAGACGACAGCAGCCGCTGGACGAGATGTCTGCCGCAGCACAAGAG
AAGGAAGACTTCGAGGCTGCGTACGTCGTGGATTCAGTGGGAGAGATGCCGACAACGTTCAAGTCGGCGATGGAATCCAGCGACGCAGACAAGTGGAAAG
AGGCGTGCGACTCGAAGGTGGAGTCGCTCCGCAAGAACGAGACGTGGACCCTGGTGCCACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTT
CCGCGTGAAGGAGAACCAGTCTGGAGAGATCGAGCGGTTCAAGGCGCGACTGGCGGCGAAGGGGTTCTCGCAGAAGTACGGCATCGACTACGACGAGACG
TTCGCGCCGGTGGCCAAGTTCACGTCGATTCGGGTGTTGCTGAGTCTGGCGGCCAAGTACAAGCTCACAGTGCACCAGATGGATGTGAAGACCGCGTTCC
TCAACGGCTTGTTGGACGAGGACATCTACATGGCGCAGCCGGACGGATATGTGGACGGAGATCGACCCGACTACGTGTGCCGGCTCAAGCGTTCGCTGTA
CGGCCTGAAGCAGTCGCCGCGGATGTGGAACAAGACGATCGACGAGTTCATGTTGAAGCTGGGGTTCAAGAAGTGCGAGTCCGACCACTGCATTTACTTG
AAGCGGGACAATCACGACATGATGTTCGTGGCACTGTACGTGGACGATCTGGTCCTCGCCAGCAGCAGCGACGGGATGCTGAAGGACACGAAGCAGGCGC
TGAGTGACCGGTTCGAGATGACCGACATGGGCCAGCTCAAGTACTTTCTCGGTATGGAGATCGAGCAAGATGTGGCGACTGGGAAGGTGTCGGTGCGGCA
GACCAAGTTCGCGAAGGACATTCTCGAGAAGTTCAAGATGGATGAGAGCAACCCTGTGAAGACACCGCAGGATCCGGGTCTGAAGCTGACCAAGGCCATG
TGCGAGGGAGGCTGCAAGCACGACGAGACCATGGCGAATGTTCCGTACCGGAACGCCGTGGGCTGCCTCATGTATCTCATGGTGGGGACTCGTCCGGACC
TCGCAGCGGCAGTGGGAGTGCTGAGCCAGTTCGCAGCGGACCCATGTCCGACACACTGGCAGGCGCTCAAGAGGGTCTTCCGCTACATCCGAGGCACGAA
GACGCACGGCCTCGTGTTTCAAGCGAGCAGCGAGGACGGACTGCAAGGCTACTCGGACGCGGACTGGGCCGGCGACATCGAGTCTCGACGGAGTACGAGC
GGCTACGCGTTCATGATGAACGGCGGATGCATCAGCTGGCGAAGCAAGAAGCAGCGCACGGTGGCGCTCTCGTCGACGGAAGCCGAGTACATGGCGCTGT
CGGAGGCCACGCAGGAGGCGGTGTGGCTCAAGGTGTTTCTGTGCGAGCTGGGCGAGATGGCGAGCGATGAAGCGGTGAAGATCTACGAGGACAACCAAGG
CTCCATCGCGTTGGCCAAGAACCCGGAGTTCCACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTGGAAGACGGTCAAGTG
GTGTTGCAGTATGTTTCGACACTCGACATGCTGGCGGACATCATGACGAAGCCGATCGCGGCGCCGCAGTTCGACGCGCTCAGGACGAAGCTGGGCATCG
TGGTCGCTGACGAGTCGAGTGGGAGTGTTGTCAAGACTGATGTGACGACGCCTCGCCAAGCGACCGTGTGACGCGAACGCGTCATCAGTGAGGTCGGCGT
GACCTTCACTGTGTTGTACCGCAATCATTCAGGTGATTACGGGACGATGATTACGTCACGGTGATTACGCCAAGATTGTGGTACAAGATGGGCATCGACG
TGGCGTTCTCTGATTGGATAAGGTAACTGTGTATCCAGTAGAGAATCCAGTAGGGTGTATCCAGCAAGAGGTATCCAGTAGCAGGCTTAGAGGTAGCACG
CGGTTGCGAACTAAGGACCTGAATCGAATCACTTTGCATTTTGCCAACTACTGCTCAAGTGTTCTTCCTTTTAAAATGTTTTGTATTTGGGGAAGGGCCA
TCGGAACTGAAATCATACTTGTAGACTTCTGAATACCAGGCATCGATTGTTTTCTTTATGATTTTACATGGGTCGTTTTGGTATCCTTTAAGGAATCCTA
AATTCTCACCGTACAGAGGGGTTTCCAGAATGTTTGAAGTCTTTTGTCCTAATCAAAGGTGGCTGCATAGTTCTGTGGAAATGCAGCGATGTGTTTGTTA
TAATTAAGAGTCTTCGTATTGTGTCGCGTTCGATGTAGATTGATATAATGAGTGGCATTTACTAATTGCACATGATTAAGCTCGCACGTTTGTGGCATTA
TCGATCTATATTTATACGATCATTATATCTTACAAAAGACGCCTCACTAATCAAAACAACATGGATACGCACTGATCTAAAATTTTCACCAAATGCAATG
AAAGATTATATGCATGTACAATGCCAGCCAAATGTTTATTGCAATCCGCAAGAGCTTGTATTATCTCACGATCAATTGCGTCCATATCGCGTATCAATAT
CCGATGATACTGGCTGCTTGGGGGATACGCCTGAACTTTATCAAGATAACGACGATGCGTATAGAATAACCATGTTAGGCGAGTAAAGGTTTTGTATCTA
CCTTGTTATCAATGAACAGAAGCAGTCAGACATAGTATGAAGCAATCTTTGTTGTTATGGCTTTTTCAGGCATCACCGTCTCGAAGATGGCTTCCACTTC
AATGCGCTTGTGGTTGTTCACTTCAGTCTGAATTTTTTCCGACCCCATCCACAGTTTATCGCTGTGTTGATTGATGAAGCTATATGGAAGGAAGGTGTGA
CAGACCGAAGGATATGATCGTCCATCCATTTTGCCCCCACTTGTCAAAGCAGTGTGGAAGCACTTCGATGTGATCAGTGATAAATTCAATCGAGAGGTTC
TGGTATGCCAAAATGGTTTCCCATACGAGATCACCAGGGCGGATGTTTTCACGAAGAAACTCCACTGAAAGAGATTCAAACCGGCAGATCATTTCTTGAT
CATTGTAGCTAAGATCGCTCCATTGAGTAAGCTCCGAAGTCTGCATGATTGTTGAGTTGGTAACCGTAAACTGATTTGCTTTATATCTCAAAGCCGCGCG
GATTGCTATTTTATCCTTAGAAGTAATGTACTATATCACTAATATAACAAGCAGTTAACAATGAGTTTTCTAGTATTCGACACTGAAACCACTGGGCTTC
CGGAAAGCTTCAATTTGTTAGCCACCATGTTGCTCTGTCGGCGATAGCGTACGCAGCATCGCAGCTACTGCCGCCTCCCCAATGACTGTTGACAGTCGTT
GGAGTGCCTCCCACTCTGGATCCGACAGGTGGAGGCAGTCAGCGCGTGCAACATGAGTTCCAGGCGAAGTGGAGCTTTCCATGGGCACCTCCGCGCTCAT
GAAAAGGTTCTCGGCTCCTCGTTCGTACAGCTCCGTACGAACGTTCAGGCAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAGCGGGCCTAC
CTTGGCTCACTACTACGGCTTACACGTATGCGCACGTGTATGAGGAAGCGTAGGTTTCTTTTATTTGAGTTAAGTATACTCGAGATCCATGAATATACTT
TAAACAAGATAAAGACTCCAAGTAGCGGGTTTTGGTAAAAGATGAGAACTGCTATTGTTGTTTTATGTTTCTGACTTCCTCTAAAATACAATATTCTAAA
CTAGGAATCTGCCAACGGCTGGTTGGCAGGATTCTGCTAACATGCAAGTCAGTCATTGGCTAAAATATGCTGCTTTCAGCCAATAGGAATCCTAAATGTG
TATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCATTGGTGTACGTTACACCAAGGTCGAGGAAGTGTTCAAACCTCTAACAGACATCGCATCT
GTTAGAGTAACAAGTGACTGTAGCTATAACCCCGTTACAGTTTGGGTATCATGTCCATAGCTTCAGCGTGAGATCACGAGCTGCTCCTGACTAACACCAC
CCCTTATCACCCCTGTACCAGTAGCTACGGCCCATGTTCAGTGTCATATCTGATAACAAACTGATGAGTAAGCTGTGATTAAGATACCGGATCGAGTGGT
ATTTTAATGATATTAAAATATCTACACTGACTACGGTAATTAGTCTGAGTCAGACTAATTACTACTCAGTCTGAGTCAGACTAATTTATGTGAGCACATT
TTTGGCGCTCTCCATTCACAAAGACTAATAATGAACATAGACTAATTCTGAACTTCATAATTAGTCTGAGAAGTATACTAAACGTAGGTATATTGTGCCT
TGCATGCTTTCTGTCTAAACAACGACGTAATTCGTTGTTTTAGCAAATCACGGTGATTAGCCCATCATTGAGTCAGGAGGCTAACTCGTCGATTTAAGAT
AGAATAGCTGCTAAGACAAGGAGTTAACGTTGACTTATGCTCACTTTCGTTGAATGGCTGGAGTAAATCCGACAATACTACGGCCCTGATATTCTAATTC
TAACTTGCTCGCTTTGTCTGATTGCTTTCTAGTCGATGATTGACATGCGTTGGCGATCTATCGTACTAAACTATTATACGTCTACAATATTGAAGAACAT
CCCTGTTTTGAGCTGCAAGCAGCTTTAAAGTCAGCGTTTCCTGCACATCCAAACATTTCTAGTAGAAATTTTCTACTGCTACTATATGCCGTGCTCTGAA
ATTCGAGCTTGGTTTAACGCAAGGCCACGACGAAGAGAGCGAAGAAGAAAACGTCCCCGCCGAAATCGGTGCTTAGTTTTATGCAAGGAGTTGGCACCAT
TCTATCGGGGACCTTATCAGTTTGTTTTCTTGCGGCTTCGTCGCGTTGCCCCCAGCGTTGCGGGACTTGTCCTCGGCCGACGCTAGGTAAACGCGGCGTA
GATCACCCTCCGAGTCCGATCCGTCTGATCCCGTGTCCGATCCAGACCCCTGGCTCGCGATCTGTCAACGTCAAGACGCCTGTGGGACTCGAACCAGGTT
GGATCCACATGTAGTATCATTCCGGGAAGTCGGGCTCTCACTAACCACCTCTCGCGACTTCTTCCACTGGTGCGACAGTCTTCCAAAACCGTGCGAATTT
GGTGCGAATCGTATTTAACCGAGAACAGGTGAGCTCCTCGTTTGCACCGCCAGTTACGCTACGCTTCGCTTCGCTCATGGCGGGCAAGGCGTCGGTAAAA
AGATAGTAACTACTTCGCAGTGCAACTACTCCGGCCTACACGCCGACCATTGCAGACCTCCGCTACGCTCCGGTTGCAAACGGTCTCTCTAAGGCCTCAT
ATGACATATGCTAGTTTGGAGTTTCGCACCAGTCGAAAGAAGTCTTACTTCTTGGTCACATATGCATAGACGGAAACAGGTCGCTCGTCTCGTACTGGTT
TCCAAGCCAGCGAGCCGCCGAGAAGATGTTAAACTAGGAAACATCTTCTCGGCGGCCGGCGGCAGCATTCCCGCGTGTTTATTCGGGTCAAACCACTGGC
GCAATTGGTTGAAGAACTCCTCCATCGGGCATTCTCCGGCTTCGTGCACGTCACCGCAGGCCTTGCACACCCTCAAGCATCGCTCCGTCGGGTGCTGGTC
ACCACACTTCTGACACGTCAACAACTTCCAGCAGTCTCTCTCAGCGTGGCGACGAGAACCACAGTGGCGACAACGCGGACGATCGCGTCCCGAGTCGTTG
GGATCAAAGTTGTGACGCGCCGGCTCTCCCGGCGGGGCCTGCCCCGCGACGAACAACTTGGCGCGTTCTTCGTCCTCCTCGTCTTGGTCGTACTGGCGAT
CGTCGCTGTCGCGACTTTCGCGTTCCGAGTTGTACTCGTCCGACGCAACGTGAATCGCATGCACGGCGCGCGCCGGCTGAGTCGGCGGGGTCGGCGCCTT
TTGGGGGAACTTGTTCGAGCAGAAGAGAGTCTTCTTCTGGTGAGCCAATCCACGTTGTCGGGCACGCAGCTTCTTCTCCAGCGCCTCGGAGTTGGCGACC
TCCAGTAGCGTGAGACGCGAGGCGAGTTCGGCCTCCTGCGTGTTCAGCGTCCGGATGAAATGCTCGACGTGTTCGCGCTTCTCTTCAGTCGTACCCTCGG
CGTATGGGATGTTGGCCCTCAAGCCCGCGACGTTGAGCCGGTACAAGTAATTCAGAGGGGTCTCGTCGGGGCGCTGAGCCGCATGGTAGTAGCGGCTGGC
CATTGACACGCCCTTGCCGCAGTACTGCACACGGAATTGCTCCCGGTCCATGATTTCTTGACCTTCCTGGGCAACTGGAGATACCATTGGCGCGCAGGGC
CGCTCATTAGATCGCTGAACTGCCACAGTCTGGCTTTCTCTCCGCTGGCGTCCCGTCCCGAGAACTCTTTCAGCTCGGAAGATGCTGAGAGGCGTACGCG
ACCGAGGCCTACGCCGCCGGCTGTCACCGTCGAGACGGCGGCTGCGGTTCTTGGCGCTCCGATGTCCAAGTCGAACAGGTCGTCGGGGTCTTCATCCGCG
TCGCGTCGAGTTCTGGACCTCGTCGAAGAACGCGAGCTGACCGACTCCATGGCGACACCCGCTGCCTCCTGGGGGCGAGCCACCGTGGGTGCAGGATTCA
CGGGCGGCTTCGGCCCCGCCGGGATTGCGGCTGTTTCGGCGCGTGGGGTGCTCATCACTGTCGTCTGCATCAGCTTGTTGATAGATTCTCTCAAGGCCTT
AGGAAGCACCTCCTCGGCGGGTTTCGTCACTTCTGTGCGTGCGGGCGCCGCGGATAGCTCCACGACGCGCGGCGGCCGGTTCATGGGCATGCGCTTAGGC
GGCTCGAAACTGCTGTCGGAGCCCACGCTTGATTGGTATCGAGGTGGTGGCGAGGGCGTGGTCGTCGAAGTCTGGGCTGGGTCCGCCGAGGGACCCGGCG
CGTCTTGTTTGACGGATCCGGCGAGAATCGTCAAGGGCTCCTGCACGACGCGAATCGCCCGTAACCAAGATTTGAGGTCCCAATCGCACATCCTCTCCAT
CTCGAAAGCCCCCAACACGAACCCCGAGTCACGCAGCATCTGGAAGAGAGTCGGCGCGGCCTGTCAAGTTGCTCATCAGCATGGGCTTGAGGAAGACCAA
GATTGGGTCTTGCTCTAGCAGACGGAAGAGCTCCGTGCGCGCCACGACGTACCGTACCTCATCGACGGTGTACTGACGTCCCGTGTCCTTGCCTTGCGGC
TTGGACAGCGACTCCTCCGCCGAGTCCGGCGCGCGCAGCTTCTTCATCTTCTTCTTGGGCGACTTGGGCTTCGTGGCTGCCTTGGCGGTGGGTTGTTGTT
GGTCGTCGGTCTTTGCAGGCTTTCGACCGGTAGGACCGCGACTTGCGTCACGGCCCTTCGCGGCTCCCTCGTCGGGAGCCGCATCGGGAACAGCAAACTG
TTCTTCGTAGCCCTCCTGGTCGTCGCTGGCCCCGTGGCCTGTCGTGAAGGTTCCCTCAGAGCTCCACGACGCGACCGGTCTCTCACTGTGCTCTCTTGCA
GTCGGCGACCTTCCAGCCGACTGCGCACCTGCCACCGATGCCTCTTGGATTGTTAGCCCGTCATTCGAAGTAGTACTCCCGGGTCGCGGCACCATTGTGG
AGTAGCGCCCTCGCAGAAATCTCGCGGAGTCGATCTCGCACAAACTCGGCGCGTCTGGATAGCGGTCGCGCCGAGCCAATTATTCCCGGTTGTTGGAGTA
GCGTATCTTCGAAATATAGGCCCAAGTCTTCGCAGGCTTCAGAGTTGGGGGGGGGGTCTTGTGTTGACGCCTTCTTCCTCCGGCGCCCGGCGCGCCCACT
TCTTCCGCGGGGTACTACACCACACCATCAAAACTTGGTGCATGCCTCGACCGGGCATACGCCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCCCG
AGTCTACTCGGGATGGTGGCTCCATCCTGAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCG
CGACTACGCGCAAGAAGAACAAGAAACACGCGTCTGTGCAGGGCACAGACACCGCGAAGACGAACGCAGAGGCCGGGCCTACTGCTGGAAATGAGCTGAA
CGAGTTCAGCTCGGACACAATCAACTTCGTGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGACGCTATTGCAGCTTCTGTTGATCGACAGAAGCTG
AACGCAGACAACGTTGGCAGGGGCAACACAAATGAATTCAAGAAGGGTTCATTGGTTTTGTTCGCTACTCAAAACCTGCCTAAACATGCCGTTTCCGACT
TCGGGGCGAGCAAGCTCGCTCCGCGCTTTATCGGACCGTTCACTGTGCTGGCACGGCACGGCAACGCCTACACACTGGACATACCGTCTAGTATGCGCAT
CCATCCGACGTTCTACGTCGGACGGCTGAAGCTATACCTGCAGTACGAGCTACCTAGCTCGGCTGAACCGAAGCAGAAGACTCGGCGGAAGCCGTCATCC
TTTCCAGCGCGACTTCGCGCTGGAGCAGCGGGTCGGGCTAATGGTCCAGCTCGGCCGGAACGGTCGAGGCGGTCTGGGAGGCCGCCGCAACCTGAGGATA
CTTCAGAGCGCCGAACCCAGCGCTCTGGAATTACTCCACGACCGGAACTCGGTCGTGGGGAGACGCGAGATCAGGGTCAACACCAAGTTGACCACACACG
GGGCGTGTTTCCACCACCACCGCCGCCAATTCGTGACGCACACGGCGCAACTCGATGGATAGTTGAGCGGATTGTTGGTCACAGTATCCCGAGAACGAAC
AGGCAACCGGTTCGTTTTCGTATCCGTTGGAGAGGATTCCCTCCCAACCAAGATACATGGGAGCCGTGGAACGTCTTGCTCGAAGACGTCCCGGACATGG
TGAGGGCGTACGAAGCCCACCATGCGCTACACGCTGGAAAGTAATACGAGCGCTGTTGTTAACAACAGCGCCCGAAGGCACTTCAAGGGCAGGCTGTCCC
GCACGTTGCCGCGCATTATACGCAGCAGTAGAGATGTCCTCCGCTGCTGCACCAGGGGTCTTCAACTTCGGCGTGCTCGTTACGGAACGAGCACGCTCTC
TTCAAACGTCACGCATTGACCAAATGGTCAATGGTGGTTGACGTGCCGAGACCAGCACGTCTAACCTTGACGGGGGGGGGGGGATGGTGAGGCGAGGCGG
GTGAACGCCTGACCGCCCAGGTGTTTAGCTTGGCGCGTCCCGGGTGTAGACTCCCGAGTGGAGTACACCCAGAACAAACCCTAGCCGGAGATAGTACACC
TAGATGTACACTCCAACTGGGGTGGCGTGTGTCCTTGTGAACAATCCCTGTGGGATCGTTTGTCTTCGTAACCAGGGGTCTTCAACCGTGGATGAGTTGT
CTTGATACTTGTAGATCGCTAGGTAGCAGGGCAGAACGTAAGCTTCCTGGACGTCGCCTCTGACAGCCTTCAATAACCAAACAATACAAACAAATACAGA
GTTATATACAAACACGTAGCCTTTCCTTATTGTTTTGGACCGTGAAAGGGTCGGTCACTACTCCAGTCAACTCCAGCCGGACTCCGGGATACTGGTCAAT
CCCGGTCGGCTTTGGCTCACGCGCACCACCCTCAAGTACTGAGGGAAACGAACACAATCAAATACCTCCTATCACACAATAGCTCTTAAATCAATACTTA
CCACCCGGGGCTTCTCCAACCGGGGTTAAAAGGTAATCGGTAATATGAAATGCGGGGCCTTCCTGGTCTGGACGAGCTCAACCGCAACTAGGAAATGAAA
TGGGATGGTCAACATCGGGTTGTCGCCCGGTACTCACCCCAACTTGGACTGGACTTGGTTGCGGGAGCTCGACCCAGATGTCACAGTTGCTGGGCCCTCA
CACGTAGACTTAGTCGGCCCTCCGGGAATGCACGTCCGGTAGACTGCTCCAACTCACTTGTGTGATCCTTGGCAAAACGAACTCTGTTTATCTGTTATCT
GTGGTCTCTCTCTCTCTGTCTGGCTATCTTCTGTCGATCTTTACATGCACCCATCTTGACTTGTCTTCACTATGGTCTTGTCGTCGTAATCGTCCGCGGT
CCCTCGTAGCATACCTCCAGTAAGTATAATCATCACTGGGTACGCAACCGAAGTTCAATGTCCCACGGAATCCGAACAGATCTTGGCTGGTCGGCTTGGT
CGGTCGGAAACATCTTGGACTTTGTATACTGGATCTTCACATCTGGGATGGTATCTTGGTATCTTGGTATCTCCAAACGGGATCATACACCACTTGGGCT
TCGCATCCGGGATGTCTTGGACAGCTTCACGGCTTCTGGGTCTTCACTCGATCCGGTCAGGCTCCTCTTGCGTTGTACACTGCACCAAGAGCAGGTGGCC
TCCAGTCGGAGGCACTTCTACGCTCCCTTGGGCTTTGCCTCTCGTTCGGTACTTGGTTCCAGCCGCGGTCCGCTCTTGGGGACATCTCCATCCGGGGTCA
CCAAACCTTGTACACTACCAACGCGAGTCCGGCCGGGATCCGCTTTCCCATACGCCACGTGTCGCTGCCTCCCTCTCCCATAGTGAGCCTCTGAGCCAAC
CAATCACAGGCGCGGCTCGGGGAATCCTCGAAAATCTCCAATCCCATCGTGTCAAACGCCCCTCTTGTTACGATCCATTGTAGAGTCCATTCGGCGAAAC
GATCGATCATGACAAGATCTCACGATCCAAGCAAGCCCAGATCGGTGGGCGCCCCAGACGGGGATGGCTTCAGTCAACTCCCAACTGTCGCGTCTCTTCT
TTGCGCCCTGTCCCAACCGGTTCACTTTTCATCAATTTCTCTTTCCAGTCTGCGGCAACGAAATCTCCACTCACAATGAAATCTGCGTGCCACACTCAAG
CCATGGACGCCCCCGCATCGAGCGCCGACGCGCCGCTTATCCCAGCACAACTCCCGTCTTCTGCGCCTCCAGTGGGGGGTGCGGAGGCGGGCGCGGGCAA
CGGCGGCGGCAGTCTGGCTGCTAGCGGCGAGACACATGTGCCGGCCAAGCCGGCCCCGTCGACCCTGCGCGCAAGGTCGACGAGGCCGGGGAGACCATGG
AGGTCGACGAGTGGGTGGACACCGGCGAGGACGACGACGCCGACGAGGAGGAAGAGGAAGAGGAGGAGAGCGCAGCGTCTTCTGCGAGGAACTCGTCCCT
GTGCACCAACGACCAGCCCGTCCGGGAGGACGAGGCCATGGAAGAAGCTCCCATCCGGGATCCTCTACGCGAGCGCACACCAAGTGTCACGGCTGCGGTG
TCCAGCCTGCTGTCGTTCGATGAGGTGATCGACTTCAAGGCGTCTGGTGTCCTCTCGTCAACCTATCCGGGATCTCAAGAGGTTGTCAACATCCTGCCTT
CACGCCACATTCTCCCGCCCAAGCGGCTTGGTGACGGCAACTCCTATCTGGTCGGTGTTCCTGCACACCCACTGGCGTATCAGTCGGAGCGCTACATCCA
GGAGGGGTATGGTGACACGGAGGCGTTGACAATCTTCGACGGCTTCTCCGCCCAGGCCCTCTATGACCTGGGTAACCTGGTTGGCAGTCAGACGGAGCTG
CGCAATAACTTGCTGCGCCTGCATGCCAACCGGGAGTCTCTCAGGCTGCCGCAAATATATAGCCGGAACGGGTCATTGTGTCCACTCTCATTTTCTTCCG
ATATAAGAACACTCAGAGACCCATTCCTCTAACCACAACCATAGCTTGCCCATTTTCTCTTCAACACTTTAAGACTCTCCAGAACACTTCTTATCCTCCT
TAGATTAAAAGAGCACTTCTCTACTTCCCACAATATCCAAACATCTTCTCGTTAAGTAAATCTTAGAGCAAAAACGAAGTTCTCATGGATTTTCTAAATT
TCAGAATAATCTCTGAAATTCAGAATTTATTGGAAAATTCAGATTTCAATAAGTCATCAACTTCTGCCTACGTCTGAGTGTCGCTCAATAGTCATTGCTA
TCTTAAGGGAAATTTAATAATATATAGGATACGATGTGCAATTACCTAACTAAAGACGGAATCAAATGCAAGCTGTCGCCGAAGAAAGACATTTGTCATA
TTCATCGGAAGTATTCGATTATCGATCACAAAAATAATGAGATTCGAAACTTGAACAAGCCAATCGCGAAGGCGAGGATGACTAACAAATCGCTACGCAG
TGAAGTTAGCCATCTCAAGGATGATATAGTCTTTCTTCGATCAGCTCTCTAGATTAAAGATAGTATCATATCCTCAATGAAGAAAGCCTATGACCAATTC
ATGTCAATCAAGCAATTTGAGATGAAGAAAGCTCGTTTATCGAAATATGTCCACGATATGACTGACATATACGAGCTAAAATCGTTTTGCAGATCGAAAG
TAAACGTGTTGACACTGTCAGAGATTTTCGGAGAACATGACGACTACTGGAGACACTACAACGAGCTGCGAATCCAAAGAAACAAGCTGTACCATGAATT
TTAGTCCATCTTAACAAAAACAAAATACTAGTATATCCAACGAGACTAAACCATGAAGAGCTACAATACAGAAGAAGAGAGACTCAACGCGAGACGAGAG
GCGAATCGGAAATACTATCAGCAAACTCGCGAAAGTAGACTCGCTAAGCAACATCAATACTATCTAGATCATAAAGATGAGATTAACGAGAAGGACAAAA
TCAGATATCAGCAAAAATACTAGCGATTAGCGATTAATCGATGAATATTTTTTTGCTACTATTAGTATAACTGAGAATTTTCCGATTGATCTTAAGCGTA
TTTCCCCAAGTAATATATCCACATAGTAAAAGGAAAATGCCAATCTCATCAGCCCTTAAGAAAGCTCAAAAGCACCGTAGCGACCTATACCGGTTCGCAA
AGAGTAAGAATCTGACAATCCATTGGGATATGAAGACAAAGAAGATGGAGGAAATTGTCAATGCGTTCAAGAGCAAGAAAGCTATGACAATTGTCAAGGC
TTTCAAGTCATCGAAGCTTAACAATGATCCATCAACTCTCAAAGTCATCAACACTACAACTGGAAAGGTCAACGTATCGCTAAGTCGCTTTAATCGCATT
CGGAAGCAGATTGTATCGCCAGCTGATAAGAAGTTGCTAATTCATATCAAGGGTTCGGATGGTAGAATCGCGAAGTCATACCACCTCAACGATCGCGTTG
TAAATATCAACAATCTTTTCATTGACGAGGAGAATCAATATAGCTCGGGAGCTGACATTGAATTGAATATTCTACCTACAACGACCATTGAGACTGAATG
GCTACCAAATTCTAAGCGATCTCGATCAGAGCGCAAGAATTTCTTTCGATATCTGCCGAAGGCCGACTACAATCTAGAGGCATTCCAAGTGTATTCAGAT
GACTTCTTGATTGAAGATAAATACAACGACGACAGCTTCGTACCGGGCGAGAGCAACGACGACGAGGCAGCTAACTATCCGTGCTTTCTGTTCGCGCTAT
ACAAGGCAGAAGCAAACCCAGATCTTGTGAAGCGGATCTCACAGACAATGTTCAACTCGGGAGCTACTGTTGATTTCATTCGGAAAACCGCCAAGGCTTT
CAACATTTGCATCTCTGTTAGGCAATTCCGTGTCAATCAGAAGACTGGCAGATGCAATAACGACACAACGATCTATGGCGATAAATGCAAACTCGATGTT
TATCCTCGGTTCTGTTGGTGAGCATCTATTTGCTATTGCGCCACCAAAGGTGCCCTCGATAACCCCGAGCTAGTTGCCGAGCATGGACGAACTGATTTCC
GAATCAAGGGAGGGAGGGTTGTTTTCAACGATAAAAAAATCTCTTTCCTCGACAGCTATGGGGTCGTTAGCTATCTATACCACCACCGCGAGACTCTCCT
GTCGCCTATCACGCAGCCTAAATATGCCTAATCTTCTCAACAACAAATACCAAGGGGTGCGCTCACTGGATGAGGGAGACTTCAGTAATTGCAACTTCAG
AGTCATGGGTCGCGTCCCAGGAAAAGAGCTTAAGCTCGGTCAGGCTGTATTTAGAGCCTTCAACTGCATGACGCGTGAGTTCTATGATGTCCGAAAATAC
AACGTGATCTACTTCGACTTCGAGACCCTGGTTCTCAACGGTATTCATGTTCCATACTGCGTATAATATAGTATTTCAGAGTTCAACGAAAACTCACCAT
CTTCTCCGACATTCAGTGAGACGAGGAACATCTATGGCTTTGGCTGCGAGAAGCAATTCCTAGAATCGCTTCCGTCCAACAGCAAGAATCTCCTCTGGGC
TTACAACGCTGGCTTCGACGCTCGTTTCCTGCTAAAACATATGAGCTACAAGTCTAAGGATACTAATATGCTTGATTGCGGCTCTTAGATCAAGCGAGCT
CACGGCTTCTATAAAGGACATGAGATTATTATTAAGGATTCGATGTCCGTCCTTGCTGGAGTATTAACTAGACTCCCTAAGATGTTCAAGGACGCGTCGT
CGTCTTTATCTCTTGAGAAGGAGTGCTTTCCTCATGCTTTGATCAACGAGAGCAACTTTAGATCCCTCTGGCCTCTCGAGTATCTTGATTCATACGACAA
CAAGGACACCCTCATCGATAATGCTTCTAAGATAGGAGCTATCGTTGATGATACGTTTGCGAGATGTATGCTACTCACTACTGCAATCGCGATGTTGATG
TACTTAGAGTATGTTTCGAAGCTTTTCGTGCCCTGGTGAAGGAGGAGTTCGATCTTGACATCTATCGATTTCTCAGTGTATCATCTCTCTCTCGCATATC
AACACAACGAGGGCTGCTTCGATGACTACTATGAAATGAATTCGGTGCTACTAGGCTTCTTACGCCAAGGAACCGTTGGTGGGCGAGTGATGGCCCGCGA
TAACGGCAAATATCACCTGAAGCACAAGCTAGCTGACTTCGATGCGGTATCTCTATATCCATCTGCTATGAGTGAGCTCCCGGGTTATGTCAGAAGCAAG
GGAAAGCTTTTCAAGGATTTGATCCCTTCTGATGCGGACTACTACGTCGCTTTGAGTCTATTGATATCAAACGCCACTTTCCTCTACTGAGTTTCTATGA
GAACGGATCTCGCAATTTCACTAATGATATTGTCGGCCAAACCATGATTGTAGGTAAGCAGGCTCTCGAAGACATTGTTCGTTTTCAAGGAGCCATATAC
ACGGTGATCGAGGGTATCTATTGGAACGCAGGTTTCACCGACCAGATCACCAAGACCATCCGAAAGATGTTCAACGCTCGTCTCAAGTACAAAGCAGAAG
GCAATCCGCTTCAAGCGGTACTCAAGCTGATGATGAACAGCTCGTACGGCAAGCTCCTGATGAAGTCGATCGTGAAGAAGAAGGTTTTCGTTAGTGGCGG
CGATAAGAAGATCGATGCATACACTCGCAAGAACATTCATCGAATGATTTCGAGAACGCCAATCAGCGATAATCTAGCTATGTTTGAAGAGCACAAGGCT
CTGAGTCAGCATTTCAGTCCGATTCATCTCGGTATCCAGATTCTCGATTCATCCAAGCATATCATGAACATAGTCATGTGTTTGGCAGAAGACATCAATG
TGAACATATGGTATCAAGACACTGATTCCATGCACATCGACTACGATAGTGTTCCGCGTCTAGCAGATGCAAACAGAGAGCTGTACAATAGTGCGTTAAT
TGGCAAGCAAATAGGTCAATTCCACGTAGATTTCGATCTTGCTGGATAGGAGGGCAACATCTTCGCCAAGGAGTCAATCATTCTTGGCAAGAAGAGCTAC
CTTGACGTTCTTGCCTGCGATGGCAACGATGCGACAGGTCTTCATATCCGCATGAAAGGCATTCCCGGTAAGCTACTCGAGGGAGATGCACACGCAACAT
AAATTAAGCTATTCAATGGTGAATCAGTATCCTTCGATTTAACCGAGCTGTGCTCGATTAACATCAACTCTAAGACACAATCAGTGTCTAAGCGTTCGAA
TTTTACACGCTGTGTTTCATTCGTGTAAATATAGAGCAGAGCTTACTCACAGCCATGGACTCACTACTTAAAAAATGTATTTTGACCCTAAAACAGGTTT
TATTGGAGCTGACAAGCTCTATCGTAAGGCAAAAGCATTTGATAAAAATATCATTAAGAAACAAGTATCTGAATGGTACAAGAAGCAGCATAGTATTCAA
CAGTTCTCGTCTCGAAGCAAGAGATTTCCTCAGTTCAAAATTGCATCCAACGACCCCTACGAATGGCAATTAGATTTAGCATTCTGGGAGAAGCAACCAA
TCCTCATTTCAGTGAATATCAATAGCAGAATTGGTTTAGCTACACTATTGAAGAACAAACGAGCAGATACTGTTCTTAATGCGATTGAAGAGTTTGTTGA
TAAAAATGAAGTTTCAGCCATATTTTCTGACAATGGCAGCGAGTTTATCAATAAATCTGTTGAATCGTTCTTTGATGAGCGCTCTATTAGTCATGGTAAT
TCGATTGCCGGCGACCACTCTGTTCTCGGAAAAATCGATCGTTTCATACGAACGATCAAGTCCAAACTAACCAAAATGAAGGAAATTATCAAATTCAAGA
AACTATCACAGTCGATATTGAATGAGGCAATCGCTAATTACAATAACACTTATCATTCAGCGATCAACGCAACACCTTCAGAAATGAGAGGGAGAGCAAT
GCTAGATGATGTTGAGTACAACAAACGCCTCGTTAAAAAATTAATACCGATATCCCACCAGGATCGATAGTGAGATATCGCTAAAGCAAAAACGCCTTTG
GATAAGGAAGGAGCCAGATGGAGTAGAACAGCTTATGAAGTAGTTGGGTTCGATGGGTTGAAAATTCGCATCAGATCAAAAAACAACCATATTCTTTTCA
GATCTCCAAATGAGCTAAAACTAGTCAACGCAAACCCATCTGATGCGGAGATCAATGACCGTGTCAATCAATTCTGGGAGGTAGAGACTATATTGGATCA
TAAAAAAATGCGCAACGGCAAATACAAATACTTCATCAAATGGAACGGATATGACGACCCGTCGTGGGAGTCTCAGGATAATCTACGCTTGATCAACAAG
AACGAGCGCAGTGCGTTGGAGAAGAAGTATTGGAGCACAGCTACAAGTTGAGGCTCTTGAAGTTCCATTTGGTATCCCGAATCGTTTCTACTTTCTCGAA
CTCGGTTGTCAGCAATCGTTTGAGCTCGTATCTTGCGATCATGATACGTCGAGCAAGCTCGGCATTTTTTTGTGATTCAACCTCGGCATCATCTTCGATA
CGGCTATTGTCATAGACTCCGGATGTAGCTAGATCTTCTGAATCAATATATTCAATTTCGCCCTCCATCGTAAATTTATGTGATTGAGTATATATATAGA
TTGCGATAAAAATACGATGACATCATGCCGAGCACTCACTAAAAGCGACACCCCATGCTCTCGCAATGCTCTTAAAATCGGATACAGTGCTCAGCACGAC
AAGGATGCTAAGATTAGAATGTACCGCAAGGAGCTATCAAAGATGCACGAGCGCGTTCGTCGATATTTGGAGATCACTAACGAA