Description :
From Genome Similarity Track
Location :
Scaffold_115:22940- 25572
Transcript NameFunction/comments
Phypl_g3460hypothetical protein PHYSODRAFT_345496
Phypl_g3461hypothetical protein

Sequence
2632 bases(100 bases per row)
GGCGGACTCGTGGGTCGatgacgccgtccagcgcctgcgccggCACTTCGCCAGCGACCGGTCCGTGTCCGTGTACGAGGCGCTGACGGCCCACGCTCTG
GACGCAGCCACCGGCGGCGCGCTGTTCCTGGGCGGCGTCTCGGCGGCGCAAGtggcgcagaagctgctgcgcatcGGCTCGGCCTCGGGCCTGCTACTGC
CTcaggcgctgggcgccgccgccgtgggctcgtcctccgtcttggcgctgcacttggcCTCCGTCCCGCGCGAGGTCtaccaggagctggcggcgcagag
TCGGCGCGCCGACggctggcggagctggctCGTGCTCGGGGCCAGGAACCTGCGGCCGCCCACGGCCTGGAGACTGGCGCGGCGCAAGGTGCAGGAGCGC
TGGGAGGATCTCCCACAGGCCCCGTACCCGGTGTACATGCTCATGGGGATGCtctgcttcaagctgctgggcggccgACTGAGCGCGCTGGCGCCCTCGC
CCTTCGCCAACCTGGGGGCGTTCCAcctcaagaaggcgtcgctCCCGGCCACGGCAGAGTACGCCACGAGCGTGGAGAGAGGGATCATCCAGGAGTTCGG
ACGCCTCTACGGCTGCCACACGTGCGGCGTCAAGAGCGGCGTGCGGTACCACGCAGACCACATGCCGCCCAAACTGTAATAGGCCGCAGTCTGGCGACGG
TCGTTTCCTGCTCTAGTCTTGGTGTTCTGACcctgtggctgctgctgttgccttGTTATTGACGTGTAGAGTGGCCAAGCGCACAGATGAGCGCTTGCTC
CGCAAGATCCTGGGACGGAAAACGACCTTCCGCTTCTACCCACAGTGCGAGCCGTGCTCGAACCAGCAGGGAAGCGTCGTGAAGCAGTGGAAGTCGACGC
TCAAGATGCACCTGCTGTCGTTCCGAGCGTACCATGCCACGGGGTTGTGGCTCGTACTGCTCTGCACCGGCGGCCTCTACGTCGGCGGCTCGAACTTCCA
CGAGACGTCCGAGGTGTCTGCTCCGATggatgacgctgctgagaCTCCTGGTGGCTTTACGTCCTCGGatttctcgctgctggttTCATTGCGCGAGCGA
GAGCGCAAATTGCGTCGTGAACGAGGCAAACGGAGCGATCCGAGTCAGATCGCCGCTGTTGATAAAGAGTTGGAGGCGGTAGCCGAGTGCAAGACGGCCG
TCAAAGCCGACATCAAGCGGCAGAAGGCCAACTAGTCGACGGCATTAACAATCAGTACAAGTTGCGAAGGCACCTTGTCGATTGACATGCTGCAAGGAGC
AGGAGTTTCATCTCGAGCTATTTCCGTTGAGTGAGCCGATCAACGGCGATGGACTCTCGGACTCACCTCACCTCACCCCACTGCAGTTGGAAGCGGACGG
GGCCATGTCGACAGCTAAGCGGGAATCGCTCGTGAAAAACTTCCCCAACCAGCGCCACCCCAGGAAGGTCGGAGGACGCCAACCCACTCACCCCCTTCGA
GGTCATCGCCACCTGGTTTCACTGTCGGAGGAGGAGTTATCGCGACGAGAGCAAGGATGGAATGATCGCTTTACTGTCGACCCACCGCCCAAATCCAATA
AGACGCAGTCGCCGGCTCCTTCACCCACGTTCAGTACCCCGCCAACCCCACTATCGAAGGAGTCCAGGATTCGCAATGAACGAGCTCAATACGGTACGAC
GAACGCTCATTCATGGATGTTTGCGACTGTTTGTCGCTAACAGTTTGAATTCCAGGTAAACGTGGCGGAAAACGCAACCGTgagccgaagaagccgtcga
gCGGGAAGCTGCTTCCTCTGGGTCCTCTGTCGAAGCCCCCTTCAGTACGCACACTCTCCACGTGTTCTTGATTGAGGGTGTTTAGCAACAGGAACTGATG
CTGTGAGTTGTTGAAACAGGAAGCTGCACAGCCTACCAAAGAAGAAAAACTGCGCTTTAAGGTTCTGAAAGCTATCGACGCCCGCGAGACTCTGCTGTAC
CAGTTGAGTGCTCTTATTCTCTGCACACCCGTACAGGAATCACTCTTCTTACCGTCAAGACCAAGTGAGCCCCCGACATCAAACAGTTCGGGTCGGCACC
AAATGCGATCGAGGGGAGGGATGGCTCTCGCGTCGACTCCATTAAGCCGACAGGGGGCAATGACAAATGCTCGTGaagcgacgaagctggcgcagcaacT
GGCTACGGATCTGCAGGTTACTGGAATTCAATGTGTTGAAGCATTAGTCGAATGGATGCTTGAGGCTGGAGCGCAGGCGGAGTAAGTACGCTGGGACTGT
GCTACTTGCTGGCGGTCCTTGGCATGATCCTAACATAGTATGTTGCTGTGTCTAGAACTCCTCCACCGTTTTTGTGGCGCGGTAGAAACTACTTCCTCAA
GATGTTCAGTGATTTGGATTTCGCGGGAGTGGAGCTACAGGCAAGGGGGGTCAACTTGGACTGTTTTAGGCAACACAACCCTCTGCTCATCAAGCCAACC
CAAAAACTAGGTCGCGTCCTGGCTGCTCATTCTATCATCATGGAAATGATAGAGTTTGCGAAGGACATGACTCCGATAGAGTTGCTTGCACTTAGTGGAC
GAATGCGCGATTCCAGCCGTGACGAGACAGAG