Description :
From Genome Similarity Track
Location :
scaffold_1284:2294- 4372
Transcript NameFunction/comments
g11253.t1 reverse transcriptase

Sequence
2078 bases(100 bases per row)
CGTAAGGCCGTTCACCAGTCTGTACAACCTGATATCCACACCGTTCTTCTTGATGATCACCGCGATTGGGGATGCCCAAGGCGATGTTGAAGGTCGGATG
ATCTTGGCGGCTAAGAGTCCCTTGATCAGATCTGACACTTTCTCGCGGAACTGCGGCGCTACTGTACGCACTCGCTGCCCGATTGGCTTCGCATTCCCGA
CATCGATATCGCATACAACTCCTCTGGCGGCCGGCGGCAGTGCATTTCCTTTGCCGATCAAGAGATGTCGCTTCTTCCAGATGATCTGCCGGAGGTTTTC
GACCTCCTGTGGGGTAGCCGATCCTGGATCACCCACCTGTAGATCTTCTATCCTGACCTCTTCCGTAGTCGAGATCGTGATCTCCGGGACAACGGCGAGA
TTGTCTGCGAGATCCTCGACCGAAAGATCGCCACTCTCGTGATAATGGACTTGATCGCTCTTCTCGATCTCCTGTGAGGTAACGGATTCTGGTCCTCCCA
CTGGTGGATCTTCACGCTTGGCCCCCTTCACCGTCTGAATCAAGGCTTCTGGAGTTCTCTGGATTTTAGATCCAGAGTTTCTCCAGGGATGGAACTCCTC
TCAAACACTATTTCGATACTTTATAATACGAAAAGCAATAAACGAGATTACGATACGGTCTGACGATTGCAAGTTGCAAATACCTACAAACTTTTATCGA
CCTGTTATCTTATAACTCATTTCTCCAAAGTACCGCCGAACGCCTGTGACTCGCCTTACAATAACATAAAACAGAATCGAATCGTTGGTACAAAGCACTT
AGTAACAGCAAAAGACCTTTGATAACATATAACCGGTGTAAAACGAAAAAACACCAGTGAATATTTCTTGTGTTCAGGCCACGGGTAACATTACAGCCAC
TCACCCATTGAATGTTGCTCGAAGAAAGAAAGCGTTTTAAAACATCCAAGGGAAAATTGCATGAATGTATAATGATCGTATTTGGAGGATTTAAAAAAAC
ACTAGGCTAGGTGAAACGATGAAGTTGAATGGTTATAAGTTTTGCTGTAGCCTGACTCGCTATTGTTTCATTGAAGCCAAGAGGACTTGCTACATGTATC
GCGAAACTTGGAGGATGAACCAGGCCGCTAGTACAGCATTTTGTCCTACATGTAACGTATTTACGTCCAACAAATGCCTATTGTCCTTCAACTCGCTTCC
TTTGCGTTTTGTGAGAATATAACGACCTTTTTACGCGTAAGAATCCAGAGCTTCCCCGTGTGAAACGCGGCATTAGTTGCTGTGATGCTGTCTGCACAAG
ATTCGGTCGTGATTCCGGTTTGAAACCCTGGATCACTCGTTTTGACCTTTATCTTCTCTTCGCAAGTTTGATCCGGGGCCTGATCTGGCATGCTCTCACG
TATCCCTCCGCTCCCAGCATCGTCACTGAAGGTCCCACGTGGATCGAATCCAGATTGCTTCTCAGATGTATCGCCACCGTCTGAATTGAGGAACGCAACT
CGGATCTTGCCTGTGCCGGCCAGTCGTACCTGTGCTCGAGCCTCCAGACTCGATATCGAGGCGGATTCGTTACTGATCTCGGTTGTTTCGCCCCGGTGGA
GTATCGATCTCGGTGTAGCATACGTTGGGCGTTCCACAAGCGGCTCCGTGGGGCCTTCCGGAATCTGGGGGGGGGGGGGTTCCGATCGAGCCTCTACAGT
AGCCTCAAGTGCTAGATTCTGCACTCCATGTAACGGCGAGATCCCACTGACACGAAACCCGGAGATCTAGGCACTTTATCTCGATCCAGTACCATTCCGA
CGTTGAGACGATGATCTAGCCTCAAGATCTTCTCACCAAGGTTCGAGATCACGAGATATCGGGTTCGACCTGGGCCATCCACCACAGTAGGTACCCCCCG
TTCTCCCCTGGTTACCCACAGCTTCTCCGTAGCACCCAACTTCACTCCGACGCTGCCTCCTCCGATTCCCCGACCGGTATCTGCAGATCTTCCTCGAGAG
TGATCGATCGCACCTTGTCACCGTACAATATCTTGCGACCGTTAAGCGGGATCCCGACTTCGTCGGGTAGACACATCG