Description :
From Genome Similarity Track
Location :
contig_10:229357- 231091
Transcript NameFunction/comments
g2783.t1hypothetical protein

Sequence
1734 bases(100 bases per row)
GGCTTGAAGGTGTCGCCGGGCCACGTCGCGAACTCGCTGGCCTGCAGCCACCAAGCCGGGTATCCGATCGAGGCCATCTGGTCGGGAGCTTCGCCCGTCG
TCTTGTAGCCGTCGCTGTACTTGGCCACCACGTCCATGCGAGTTCCCACCACTGCGCCACGACCTGCTCCGCGAACTCGTTGCTCTGCGCTTGCAGGCGG
GTAACCAGCTCGGTGTCACTCACGCTACCAGAGTGACGCTTTTCGTGCGCCTCCTTCTCCATCTTGCGTCGTCGGGCAAAGGCCTCCTTCTGCAAACTGT
CGATCTTGCCTCGAATGTCGATGCTCATCGAGTTGTAGCGAGCAGACTCCAGTTGTTCACGAAGTTGAAGGCCCACCAGGCAGACTGCGGGTTGAACTTG
CTTTGTTGGCCCAGCAAATACGACTTGGGCACATCGTGCTGCGCGCAGAGAACGGAACGAAGACCGAGCCGTGCGGGGCATCCTGAGCATACCATGCAAC
GCCACCAACAGCATCCGGCCCCTTGTTACTACGACTCTGCAGAACGAAGGCAAACAGCGTGCGGTACATCGAGATCGGTCGTTCCCAGCCGCCAATGACG
CCACCGGGGCTACCCGACCATCGCACAGGGGCTCCGGGGCCAGCAGCCAAGCCCTTAGTCATGTCGTAGCGCGTGTTTTCGTAGTGGTCGCGGAGTAGAT
CCATGATCTGGAACATCTCCACATTACGGTCGGGCTTCACGGAGAACGGGTAGGTGGCGTACTGCGAGAAGCTGCCGAGACGGGCGTCGAGCTGCAGCGA
CGGAGCCAGCACGTCGAAAACGCGCCACACGCGGCGTCCAGTGTAAAGCGGGCCGATGGCATCCTTGTCCGCAAAGCCGTAGGCGGCAGTGAAGTCGAAG
GGCTTGTCCCCCTTCGGGTCCCACCAGTTCATTTCTTCAGCAAGCGAGCGCACATTACTCGAGGCCATGAACCAGTCGGGCTGGCTCAGGTCGATTTCAC
GGATCGTGAAGCCGTTCGCAATCACCGTCACATGACCGTCAGGCACGCGCTGCGCTGCCCACACAGCCCAGCTTCGTCCTTGCCGGTCATGACGTGGAAG
ACCCAGACCTCACCCAGCTTATCTCCAACGACAAGCGCTTCAGCCGAGTCGCCGAAGTCTGGTTTCGCCATATCTCCGCTGTCTTCGCTGTAGAAGCCGT
ACTTCTCGGCCAGCGTCCCATGGTGCCCACAGCGCACGCGCAGTCGCACAGCGTTCAAGTGCGATCTTGGTGAGCTCTGCGATGCCGAACATGTTCTTGC
CTCCAGGCACATTCAGCGGCCACCCGGCGGTCTTGGCCCCGCATGTACTTTCGCCAATGCTGAGCTGCACCTCGTTCATCATGCCATAGTCCTGGTCGAA
GTACCCATACGTGTGCTCCACCTGCGGGACGTACCCAAGCGGCATCATGTACTCCTGCTCCACCTCTGCTAGTGGGTCGTGCACAGGCTGGTAGTGGGGG
CCACGGTCCGGCGCCACTACTCTCGGGTATCCGCCGTTGAAGTTGTAGACGGCACGCTTGCTGCCCGGCTCATGATCTTGCGCCGGAACGCGAACAAGGC
GCAGATCAGAGGCTGCATCACCGGCATCGTCCGTGTGCGCGATCAGCGTCGAGTTGTCTGCGCTTGCTCCTTGAGTCACAGCAATTGCTGTGCAGGCATC
GACTTGAACCTGTTGCAGCGAAGCCACCGCGAGC