Description :
From Genome Similarity Track
Location :
Scaffold_127:22932- 25819
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_127-snap-gene-0.16Pro-apoptotic serine protease nma111

Sequence
2887 bases(100 bases per row)
AGCCTGGAGAAGTGCATCCGCGCGATCGTGAGCATCCGCCTGCTGAGCGTGCGCGCGTTCGACGGCAACGGCGCGTCCTTTAGCGTGGCCACGGGCTTCG
TGGTCGACCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCAACAAGGAGGAGG
TCGACCTCGTCGCGATCTACCGCGACCCCGTGCACGACTTTGGCTTTTTCCGCTTCGACCCGAGCAAAGTCAAGTTTCTGGATCTCCACGAGATCCCATT
GAAGCCCGAAGCCGCGAAAGGTAAGAAGCGCTGCACTTGTATATCTGTTATGGTGCGAACGACGATGCTATCGCTTAGAATGAGTACTAACCATATGCAC
ACGTGGCGCATGCTGCCGTATTTGTAATAGTCGGTGTCGAGATCCGTGTCGTTGGAAACGATGCGGGGGAGAAATTGTCCATCTTACCCGGCATTTTGGC
AAAAGTGGACCGTGACGCGCCTTCGTATGGATCCAACACGTACAACGATTTCAACACGTTTTACTATGCTGCAGCGAGCAGCACGTCAGGTGGCTCAAGT
GGATCGCCCGTCCTCAACATCGATGGGTGCGCGATCGCATTGAACGCAGGCGGTGCGAAAAAAGCCGCGTCGTCGTTCTATTTACCACTAGATCGCGTGG
TGCGTGCGCTCAAACTGGTACAACAAGGACTCGACGTGACGCGCGGAACGCTGCAGACGATTTTCAAGCACACGGCATTTGATGAAGTGCGTCGACTGGG
GCTGCAGGCAGAGACTGAAGCGGTGCTCCGCGCGCAGTTCCCAGCGGAGACGGGGATGCTTGTTGTCGACCAAGTCATTCAGCATGGCCCTGCAGACCAG
AAGCTGCAGACTGGCGATATTCTGATCAAGTTTGCGGGTCAATACGAGACGACGTTCTTGAACATTGAAGAGTTTCTAGATTCGCATGTGGAACAAAACG
TCGAGATCGAGTTTCAGCGCGGTGGAATGACGCACGTCGTCGAGGTGGAGGTCGGCGATTTGCATGCCATCACCCCGCATCGGTACCTTGAAATTGGAGG
TAGCATCGTGCACTCACTGTCGTACCAGCAAGCCCGAAACGCGTCGTTACCAGTCGGAGGAGTGTATCTGGCCCAGGCAGGACACATGTTTATGAAAGCG
CACTTGACCCAGCCGTGCATCATCACAGCCGTGGATGGGAAACCGACCCCAACGCTGGACGAGTTTGTGCGCGTGCTGTCCGCCTTGCCGAATGGATACC
GGACCGTATTGCGATATTTCATGATTCGTGACCGCCATCGCGTGCGCACAGCATTCATCATGATGGATCGCCAGTGGTTCCCGATGCAGATTTGCACGCG
TAACGATCGCGATGGACTCTGGTATGCTGAAGTTTGCCTCGATATGTCCGCGTCGAAAAGTCTGGAGGTTTCCATTCCTTCATTTGCACCCGCACCACTT
AGTTTTCCAGGAGGCAGTGAGCTTGGTAAAAAGCTCCTTCGGTCGCTTGTGATGGTGTCATTCGACATTCCGTACATGGTCGATGGCATCTCCAGCTCCA
GCTACCATGGCATGGGGTTAGTCATCGACGCCGACCAAGGGTTTGTTCTCGTTGACCAGAACACGGTTCCGATCGCACTTGGTGACGTGCTGGTGACGAT
CGCGGCATCCGTCGAAGTCCCTGCAAAGGTGGTGTTTGTGCATCCAGTTCACAACTTTTCGATCGTAAAGTATGACCCCAGCCGGCTTGGTGCTGTGGCT
GCTCATCTTACTAGTGTCACGTTTGCAGAGAAACCACTTGAAGTGGGTGAAACGACCGATTACATTGGGCTGAGCAGCAACTGGACAGTGGTGACGATGA
AATCTGTCGTGACGAAACTGGACCGTCTTGTGTTCCGCGACTTCCAGCCACCACGATACAAGGCGTCGAACGTAGAGGTGCTTCACTTTGACCGCACAAC
AAAGTCAGTCGGTGGGGTGTTCATGGATGAAATGGGTGGCGTCAGCGCTCTGTGGCTGTCATTTAGTTACCAAGACGCTTCTGGGAGGAAGGAAGTGTTC
CGTGGGCTGCCAATCAGTGTTGTTCGCCCTATCGTCGACGAGCTGCGCAATGGCCAGGGACGAGTTCCGTCGTTTGTAAACATCCTTCCGGTTCAGTTAC
TGACGTACTCCTTGTCGAAAGCGCGTTCAGGGCTTGGCTTGTCGGACGATTGGATCCAAAAGCTTGAGCAATGTTACGAAGACAAACGCCAGATTCTTGG
AATCAAGCGTAGTGCAGCAGGAACCGACTGCGCGAAGAAACTGGAGAGTGGGGATCTGCTACTTGAAGTCGACGGACAGGTGGTCGTGCGCGATTCGGAT
GTCGAGTCTGCCGTGAAGGACAAAACAAACTTGGACCTCCTCGTGCTGCGCAACCAGGAAGAGCTCCGATTGTCGGTGGAGACGAACCGACTATCTGGCA
TGGGCACNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTCGTTTGGGCCGGGCTGGTCTTGCAGCAGCCGCACTACTCTGTTGCTACTCTTGGGTACATCC
CAGAGGAAGGTGGTGGGGTCTACTGCTCACGTTGGTGTTATGGTTCGCCAGCGCACAAGTACGGCCTTCGCGCTACAATTTGGGTCGTGGAGGTGAATGG
CGAGCCGACTGCAACGCTGGATGAGTTCCTCAATGTGGTGAAGAAGCTTCATAATGGCGATTCAGTGCGATTGAAGACGATCGCGATTAACACGAAACCA
AAAGTGTTCACACTGAAGACCGACTATCACTACTGGCCAACCGTCGAGCTCCGCAGAGAAGAATGGGACTGGAAATATGTGTCACAT