Description :
From Genome Similarity Track
Location :
Scaffold_49:229317- 236016
Sequence
6699 bases(100 bases per row)
CGTCGACCTGGAAGACTCGCTCGCGCCGGTGGCACCTCCAAACAAGGGTTCTCCGACTATTCGAATGGACCCCGCGTTGCTGATCGCCAGCCTTCCCCGT
AATTACAGCGGATTCGTCATGTCTTTTGACGGATCAGCGAAGACAGAGAAGTACGGTGGCTACGGGAGTTGTTCATGGGTGTTGTAGAGCCTTCCTGAGT
GGAAGATAGTGATTGCTGCAAACGCTTACCTCTCGGCCACCACGGTGAATGAGGAAGAGTACACAGGAATGATAAACGGTGTCAAGGCTGCTATTGCGCA
CGGTGCCGAGGATTTAGTCATCGTTGGTGACTCAAGGCTCGCGATTCAACAATCACTAGGGGTGATCGCATGCAGGAAGGAAACTTTGCTAGCGCTGCTG
AATACTCACAAGGAACTCACGGCCAAGCATCGATCAGTTAAATATCTTCACGTTGTACGAGAATACAACGCTGCCGCGGATTCACTAGCCACTGAAGCAC
TGGAATCGAAGGTCAGTCGTGTCATCCTGTCTGAAACTCGCAAGTCGGAATTGGCGTCGCTGAATCGCATCCAGGTAATGATATACGAGCCGGATGAAGA
CTCGGTAGATGTTTCGTCACGTGGAGCAGAGCATCAAGTACATGTACTGTCAGGCAGCGAGTCTTCAAAGTGGAAAACTTTCGAAAATTTCGTGGTTGAT
TACAGCTCACCCGAGTGTGATTATGGTAATATGGCAGTGATTACTAGGCGACAGACGAAAGCCAAGAAACGCGTCAGGTTTGCAGATGAACACTCGGAGG
GGGTCTCAAAAGATCAAGAACAGCATGAAGAACGACGAGAGACGTCCACCGAAGATTCAATCGGCGAAGATTTGCCAGACCATCCTCACAAGACTGTACC
AGCGGCATTTCCCGATGCGGAAGATGTTGACCCGGTAGCGATACAGCGGGAACGACGCAGACGGATAATGGTGGCACAAGACGAGGCGCAGAAGTGGTTT
AACATCAAGAAAGTGCTTCAGGGCCAAGCAAAAGAGCTGAGTTACAAAGAAGCTCGAGATGCCTGGAAGTACGCTGACCGGTTCGTGTTATCAGAAGACG
GCGTGCTTCACTATCTTGGATTGAATCGTCGGTACGACCACGGTTGGCAAGAAGAGACCAAGCTGCGGCTTGTGGTACCGACAACGATGATTCAAGAGGT
CTTGCAGAACTGTCACGACTCGCTGGAAGGAGGACATCAAGGTGTGGTGAGAACGTTCCATCGCGTTGAGTCCGATTATTATTGGATCGGCTTGTACGCT
GACGTGGAGAAGCATGTGAAGTCATGTCCAGATTGCAGCTCGAGTAAAAGCCGTCCGCAGCTTCGTGGATAGTCGCCTGGCAACGTACTAGCCGAACGAC
CTTTTCAGATCGTCTCGATGGATTTTGTGATCCCACTACCGAAAGCTCGCAGGGGCAACACGGCGTTGCTCCTATTTCAGTGCTCGTTCACGGGATTCGT
TCTTGCCAAAGCTATGTCGGATACGACACTGAGTGTTGCCCAAGTGCTCGAAGAATGTGTGTACCGACGGTTCGGGGCCCCATCACTGATAAGGCACGAC
CGCGACCCACGCTTCATGAGCGAAGTGCTCCAAGCATCTGCATAGATGATGCAGTCAAGATCACGGGCGACTTTGAGCTATCGGTCACAGGCTAATGGAC
AGCAGGAACGCTCGGTGAAGTCGGTGATGGGTTCCATACGGGTGTACGCGGAAGACCCTCTACAGCAAGATTGGGACGAAATTGCAGAGAAGCTGGTGTT
CGCTATTAATACTTCTCAGGACACTACAAGAAAGGAAACACCGTTCTACCTCGTTCATGGTTGGAATGCGCAGTCGACGTTGCGGGCGATGTCGTCATCA
CTCAAACGAGGACTCAGCAAGCAGTCTGACGCTCTAGCGTGGCGGCGTGAGATCAATCGACAACATGAAGTCGCCCTCACTATGGCCAAAGACTATCAGG
CTGTAGAAAAGGAGCGAAGAGCTAAAAAGCATAATGATGCCCTGCGTCGATTGTAAAAAGCCGCTGTACCTTAACCAAGTGGAAACGAACACTCGGCGGA
CCCTCCAGAAGCTTCGGAAGAGATGCAAGATCCTGCAAGAGCCCCACCGAGATCTCTTTTTGATATTGGGAGCCGGGCGTGGCTGTACATGGAACGCGTC
AAACCGGGCTTGACAAAGAAATTAGCTCACCGGTGGCATGGACCTTTTCGGATCAAGCGCAAGGTGGAAGAGTTTGCGTACGAGCTGGAACTGCCTGATC
GAAGTGGGTATCGCTTTTACCCAGTAGTGCATGTGTCAAGACTCAAGGCTGTCAACGAATTCAACAGTCGACCGAACACTCGGTTGGTACTTGACGCGAC
TAATGAAGCAAGACTCGATTTCGATGAGGAACTACTGCCTGAGGACAGCTGGGAACCGGATCAAGTTGCCGGTGAATATGAAGTCGAGGCCATCCTCGAC
GACAGAACACCACTGTCGACGAGCACGGAGCGTGCTGTACGCGAGTTCAAAGTCAAGTGGGTTGGTTATGAAGATCCAACTTGGGAGCCAGCATCCACCT
TGTCATGTGGAGGTCTGCGGTACGACTATTTGCGAGCCAAGAAGAGCGAGAATCGGCTGCAGATGGCGCAAGTGGCGGACGAAGACTAGCGTGACTGGAT
CACGTGTAAGCTGTCCACAGGGCGATGCAGCCTGTGGTAACAGACGAAGAACGTTACTGCAACAACAAATTGTATATGCATTTGAAGAACAACATGAACA
TGATTACGCTGTGGAAGTGGATTAAGAATAAGAAAACATGAATGCCGACCGAGGAGCGACCACTGAAAACGAAACTTCGCTGGACCCATCAACAGCTAGC
TGAGATGCTGGAGAACGTCGTGGAGCATGCAGCGAGGATTCAAAGCGATTCCAATTGCCTGGCCGCGGTGGCCAAGTGTGCCAACGAAGTCGAGTCACCA
CTCTCCTTCTCCTCTTCATCAGGAACCTGAGCCTCGGCAGCTGGAGCTGCAGCCGGGCCCTGCGAATCCTCGGCACCAGCTTCAACAAGAGCAGCAGCCA
GAGCGGGACGTGGAGTAACCGGTGGCGAGTCAAACAACGAACGCCATGTCGGAATAACTTCAGTAGAATCCAGAGACGGGTCAGCGATCACGCTTCGGTA
CACGTCCACGAAACGTGTACCACGAGGATTGAAGAGCTCCGGATTACGCTGGCACGGGAAGTACGTGGTGTTGTACGGGTGCTAATGCGGCGCATTCATC
CATCCAGTACGCCAGGGCTGACGAGCGTCGAGAGCCGAAACTTCGGAAAGCCAGTCAGATGTCCGAGGTGCGAACGACAAGTTTTCAATGGGGTACCACG
GCTTCGACGGCTCCAAAAGCAACTCGGGACGAATGAACGGCGCGCCAGAAGTACCAGAGCAAACCGAGTCACGCCTCCACGCCATGTACTGCTCACGGTA
CTTGTTACGAAGACGATCGGCACGACGGTCGTGCTCACTGAGAAGCTTCTTCAACAGAGCTCTCAGTTCGTGGCCAACCTTTTTACCTTCGTCAGCGAGA
CCTCGTTCAATACCAGCCAATGGAAGCCAGTGGAGACGCTCCCACAACGCGGGGCCCGAGGTAACCTTGCTTACCGCCGTCACCCCGAAGGTTCGCCCAG
ATCATCTTGAGACGGGTCTCAATCGGAGCACGCTTTGAGATGGGGACGCTTGGATCGAAGCCGACAGTGTCGAAGAGACAGGCTTGAAGAGGATAGAGCT
GCCGAAGTTGCTGGTACGGGTGATCAGGATGCGAATAATCAAAGTACGCTTGGAGACCCTCCAACGTTGTACACACGGTCACCTCACCAGCTGGTCGGGA
AGGTTTAAGCTCAAGAGTCGCTCGAAACACTTCTTGGCGCCTGCGTCAGTAAACTCCATGACCACGTACGGAAGAGCCCAAGGTGGCAAGGTGGACGAAG
CCGGCACCGTAGGGCGAACACCAGACAACACTCGGTGAGGCAACGGCTCAACCGACGGTCCACCACCACGACGCGGCACCGAATTGTAGGAGGCCGTGAT
CATGCGCCCAGGTCCAGCATCGAGAGTCCAAATAGGCGGCCGAGGAGACACCGGAACAGAGGTGAAGATGCTGGTGCTGGGTGACTTGCCGGTGACGAAG
GAGGCGGACCGCCGACCATGATTGGAGAAGTCATCATCGGCGAAGGATTTGGCCGAGGTGGAGTCGGAGGACGAGCTGGGCCAAGATTGCTCCAATTTCT
ATCGGAATCTTCAATATCTTCGTCATCAAGTGTGCCAGAATGATCGGTAGGTGGCGGAACATCACCGCCACCACTGGGGGCATCAGGAGAATCATCCATC
GAATGTTCATTGTCATTAACGTCATCTCCACGATCGTCATCAGCATTTCCATCGTCATCAATCTCCATCGAAAAGTCGGGCGAAGACACGCTTGGTACGA
CAGCCGTCGGAACAATCGGAGCCGGCTTTGAGACACGGAGGCTGGTGGAGCAGCTTCAACAGGGGCAGGCCCTGCTGTAGAAACCACTCCCGAGACTTCA
ACTGTATTGGACGTCGCAACGGACGCCGAAGCAGACTTGCCTTGTGGGACAGTGTGGTCCGACTCTTCACCTTCATCACTTGAGCCGAACATGAGTCGCA
TTTGCTCGGCCTCACGCAGAGCTTCTTCCGCAGCACGTATGTCGGCTGGAGAAGGAGAAATCGTTGAAGCTGGTGGCTTGGCCACATCGGGTGGTCCCTG
AAGCGGGGGCGAAGGCGCGTCAGGAGAATCAGGAACATCGTTATGATCCCCAGGGTCCACATCTTTACCCGAAGGCTCTGTGGCAGTTTCTTGAACCGAA
GGGACGCTGCTTGGACCAGCATTCCCCATGTCCACGTCACTCTGGTCGCCGCTGAGGTCGACCACGGCAGGAGTTGAGGAAGACGCTGGTGGCGACCATG
AACTTGGAGAAGACGGTACAGACTTGGACCGAGTCTTCATATGACGACGAGGCGACTTGGCAGGAGAATGAGGACGAGACTTCTTGCGCTTCTTCTGGGC
CGCCTTCTTCCACGCTTTCGGGCCGAATAGCGATCTACGAGCCGACTTGAGGATCGTCCGAAGACGCGGTAGCAGACTGGATGCGCCGCAAAGCGACTAA
CGTCTCTTGATCCAAGTCCAGCGCGTCCAGGTCCAGCTCACCCGCCGTCAGACCTATCACGAAGGATTGTGAACGAACGTTAGTTGCTGAACACACGGTG
GAAGGAGCGACATTAGGAACGTACCATCAACAGCCAGACGAAGTACCTCGGGATCCATCCCGGCCAGACTCACATGTGCACGGAGGGTGCGATTCGCTTG
GAGGAGACGAGTGTTACGGTCTTGCTGGTTCTCGAGGACCTTGAGCGTGTCGTTATCAACATACTTGCCCTGGGCAAGCTTTACCAGAAGGAGGTGAAGC
TTCCGAGTCTGCTCGGTATTTGCACCAATTGAAGACTTGTACACCTCGCGTTCGCGAGCCAGCTTCTTGTGCAACGTGTTGATGAAAACGTCCCGAGCTT
GGACCTCGCAGTGAAGACGATTCAAATCCTCTGCGTGTCGCTCCATAGTGGCTTGAACACTTGCGAGCATGGCGTCATTCTTGGCGTTCGACTCGCGGAG
AATCTTGATGTTGTGGTGTAAAGCTTCAATCTCAGCGTTGGCAGCCTTGAGGAATGTCTCCGCGTTCTCACGAGCCATGATTTGGGGTGCCACCGAACGT
ACGGCGGCAGCAGCCTCGGACTGAGCAAACCGCAACTGACGCTCCAAGCTGGCGACTCGTTCGTGTAATGCCGACAGCGCGTCAGGAAGAGGTTGTACCG
CAGCGAGGACATCATCGAAACCAACAGCAGTCTCGAGGCGACGTTGAGCGTGGACATCGCCGTGGAGAGGAGGCGCAACGCTGCGCTGCACTTGGTGGCG
AGCCATGGCAGTCAAGTACGGAATTGTCGAGGTCATCATGTGATCGACCGATGCCTCCGTACTTTCAGCCAGCATGGCGCGCAGCGAATCCTTGGTGAGT
GGTGGGGTACCACCAGCAGGCGCAGGAGGACCAGCAGGAGCCATCCTTGTAGATTCAGCTACGACAGGAAGTGCTGCAGGAGCTGCCGCAGGGGGTGAAG
AGTCCGGGGCAGGAAGCGCCGGAGGACCAGCTGATGATGGTGCTGTCAGGGGAGGTGTAGCAGACTGAGGGGCGTTCGAACCCTCGGTCTTGCCTACTAA
GAAACAAGACGAGTAATGCATGGTGATGAGCAAGGCGCCGATGATTCAAGAAGAGGATGAGCTGACGTACCTCCAGCCGTTCACGTTCGCGACGTCGGCG
AGGATTGAGACGCTAAAACACGTTCAGACGCTTGGACATACAGTGACTGGATGGTGAATTGGAGAATGAAGAAATGTCACAACGGGCACCAGTACCGTGG
CTTCCATTGCGACAGGGGCAGTTGTGGTGTAGTGATTTCTCCGTAGTTGCGGATTATCACCCGTCGACAAAGACGTGACACCGCCCAAGATGTTCAAGCG
ACGAACCCTCGGTCATGTGATGTACGGAGACGCCAAGGTGCAAGGGACTCGACGGCGTCACTTCCGAGCTTTCATCGAGTATTGGATACGGCCATATGT