Description :
From Genome Similarity Track
Location :
Scaffold_415:22930- 29955
Transcript NameFunction/comments
Phyta_totarag8092hypothetical protein PHYSODRAFT_476772
Phyta_totarag8093hypothetical protein PHYSODRAFT_284561
Phyta_totarag8094hypothetical protein PHYSODRAFT_358780

Sequence
7025 bases(100 bases per row)
TGCTGTGCTCATTGGGCGGCAAACGGTCTGTCTACGCTGATAACGGTGGCCCTATGAGAGGCCCTCAAACAGGTCCATGTCTATGGCTTCAGTCTTTTCC
GTCATGAAGTCGGTgtcatcctcatcgtcggTATCGGAGGAGGCATGGTGACGCGCCGCGGCCTTTCCAGAACGACGAGTTGGCGTGCGGATGCTGACTC
CATTCGAGTTTttgccgttgctgctccCGACACTGCCAGTGCCCTTGTGCTCGCTCGTCCTGGATCGAGTGCGAATGACCAGCGCGGCTTCCTTGGGCTT
CTGGTACTGATACGTGTTATTGCTACTGGAAGTCGACGAGTATTTTGCACGTAGAGCTCGCGTCTTCTCTTCACTTTTCTTCGCCAAAAAGTTCTGAATg
agctggcgctcgtggtTGCTCATGTACGCCATTTGCACGTTCGTGTCGATCACCAAGAAGAGTTCCTGGTACTCAGTCTCCTTGTGTgcgaacgcagcag
caggcgagaATTCGTACGAAACCACCTCGAGGATGTCAATCGAGTCACGATGATACGGGATACGTGCGAAACGTAACCGCTCTGCTGGGATCGATAATGC
AGCACTAGCAGCGTCCGTCAAATACGTATCGGGGTGGTTCTCCTCCTCTAAGGTAAACATTACCACCTCGCGCCGCAAGTCCTTGACAAAACGCCACGTT
GCGCGATTCACATAGGCAAATTCAACAATCCGGTGGTTGACTTCTGAAGTTTCCGGCTCCGACAAGAGTTCTGCTACGATGCTCCTTCCTTCATACACTG
CCAGTTTTGATGCCTCCACGAGCTTCTGGCCATCCACCAGAACGCTTGTCATCGTACTTTGACGCAAGTCGCGAAGGCGGATGTGACATGGAGTCAAACT
TCCGTCATTCGCTTTCACGAAAttcttctccaccaactcATTCCACACTTTTTGACGAATGTCTTCGACCAGCATCTCCTCGCTGATGACGATTTGGCTC
ACAAACTTCAGCAGTGAGTCATCCTTCCCTGTCGCCACTAACACTTCATCAATGTCAAACAAGTCTTGGCTGTCGTTACCATCTGCTGATGCGTTCGTCA
CGGTAGGCTGAACCTGGTTACTGCTGGCATCGCTCTCTGGTGAAGGTGAACCGGCGTTCGCCGGGTCATAGAACATCAACCTGAAGTTGTATTCCCCTGT
GTTCAGCGGAGTGCCCTCCAAGGCAAAGACCGTGTGATTCGAGCCGATCGACAGTTTGGATAGAGTGCTATCGATCGCCTTGATTTCTACGCCTGCACTG
TTGATGCCACGTAAAAGCTTGAATGTGTTCGAGGGCAGCCCAATCTTAGCGCTAATTTTCTCTTTTAACGCGCGGATAGTCTCTCGTCTGTCGATACGAA
TAGGCTGCGCCGGACTCGCCAGGTACTTGAAGTTGACCGTGATCATGTTGGCTTCGCGCTCGAAAAACGCCTCGGCAGGTGACGCAAGCGTGAGGTCTGG
CGTCTCCTCGAAATACAATTCTGTTCCATTCACCAAGTGTAAATCCCTCTTAAGCCGCAGGTTCAGCGtgcgctcttcttcgtttgCATCTAGAATCTTG
GCCGCAGAAATGCTGTATGTGGTTGCACTTTTCTTGATGAGGCGGATTTTGTAGTCAGCTGGAACGGAGAACTTCTTTGCAGTCAGAGCGCAGAGTGATG
CAACGTCCGCTTCCTCGTCTACCTGAACGCACCTCGCCATGAGCGAGTTGTAGGATgacttgctgttgctgtctgaTTCTGGGTCAAAAAAGCGACGAAT
AAAGAGCTGTAACTTCGTCGGGTCATGTTCTTCCCATTCCTCGCCATCGCTCTTGACTTCAAGGAACATCTGCTGGCCAGCGTAGATTCCTAACGACGAC
AATGCCATGTCCTCCTTGTCGTTGTAAGTGTCGGATAGTAGGCAGTTATAGTCGTTGTATCCTCGCAACCTCACGTTCTCAATCGATGGGACAATGACAT
CCTTCTCCTTTGCGAACTCCTTGCACGCTGTTTCAAGTGCTTCGCGGATTGTTGAAGTTTTGTATAGGTGGATGGCCTTCTCTATGTTTTTGGGCTTGGA
TCCCTTCATAAAAAACTTCACCTGtaccttcttcgccatctcTAGCCGCTCCTGCTCAAGCCTGCGAATCTTTTCCTCGTCAGCGCGGATCTTGTCTTTC
AAATACTGCGGAATACTCTCCGGCAGGATCATGTTGACATTCTTCTCGGCAGAAACCAGGCGGTACAGGAGCATGTACGCGCACGTGCTGTAGCGCATGC
TGTAACCAGAGCCACTGGCGCCTCCAAACGCTGTCTTAAGTTCCGTGTCTGAGATTTCACTAACATTGGAGTCATTAAAGTTGTACCACTTGCCCGTCTC
CAGAGACTTTATGTACGCATAGTAATGTCCACCGAGCGCGCTGCCGGAGTGGATAAGTACAGAGTACAGCTCGTACACATGGGGTCCTGAGCGCTTGATC
ATGGCCTCTGGGTCAAAAGTGGGGCTCCATGTGTCGAACGAAGTGGTTCCATCTACATCATCatcctcatcatcgtcgtcctccttTTCCTCGTCTTGTA
CAAACGTCATCGGCTGTGATTCATCCATAGACGACAAGCGGCGCATACGTTCACCCATTGCGGCAAGTCCAGGTGTcggaggaggtgaagaaggtgttgT
AGGCACTGAATCTTCATGTGATTTATGGTGGTTTTTGCCCTCCAGTTCATGACGTTCCATCGACATTTTTCTGGCAATTTTACCGCGAGCACCGCCATTC
TCATCACTCACATACGAATTCATATCCAAGTACTTCGGGAACGTCACGTTATTGTGCAATTTAATGCGGTTCATCGTGGCATAGTCAAAGTCGAAgcgct
tcagctgcagcatcaaaatATACGGCAGTTTGGAGAACTTGAGTCCCTTAATCGCATCCCGTTTCACCTTGCAGCGATCACACATCCACTGGTTTTCTTT
GTCCAGCACTTCCGGTCGCAAAAACAACTCAatcgcctcctccaccgtcttcatcatttcCGTGGACCCAAACGGTCGAATAACCAGTGACAAATCTAGA
AAGTTGTCAATTCTCGAACTTTCATAGCCACACTCGCAGCACTGCACGTAATCCTTCAAGGATCCCTGGTACAGATCATTCACCAAATTTTCGTTCATCG
TGTCCTTGAAAGATTTCTCCagagcgtccagcagcactctgCACAGCTCCTGCACGTCGTGTTGCTGAAACACGTCAGCTCCCGTCCACCCGAAGCTCTT
GGTCAGAGCCTTAGTAGAAATAGCGTCCTGCGTCGTGAGTTGCAGCTTGGCAAAAAGAttctgaagctgcaacgggatgttgtcttcgtctgcctcttgg
tcgtcgtcatcttcctcgtcttcttctttctcctccttctcctgctcctgcaccgCCACATTCTTGGCCGCACGGTGGCACGTCCAACCGTACAGTCCCT
GGCGGAACTCTGGCGTCATGAACAtgctctgcagcagactgTTCATGTAGCATGTGGCTCCCTGGTTGGACAGCCCCGTGTAGACCTTTCGGGGTCTGCT
GTAGCCCCCAgagctgctgtagctgctgcctccgttGCTCGTGTACCCTGGAGAGTCGTATAGCCCCTCGAGGCCCGATGAGCTGTACGTGGTCAGCGCT
GTGGACTGCACACTGGGACTCGTCGCGGTGGGCGCCgcgctgtcgccgtcgtcgtcgtcgtcgtcttgggCGGCGCGCGGCAGCTGTGTGAGCACGGAAG
ACACGTGCTCCCGGTGCTGCTCGCGAGAAGCCGAgaattcgtcgtcgtcgctcgaaTCCCAGCCCGTGCCGGAAGGTTTCGGTTGGTCTGCAGGTCGCCA
GTCGCTCATGATCTGTTTGTCACTTGACTACCCGTGAGGGATTTTCGCTACTGAGATCTAATACCGGTGTGAGGGAGGATTGTTGGTGGCGTTTACATGA
AATAAGAGTACCGTGGATAATGAAGTAGAAATGACAGGTCGCGACTTACCGGTATACAGAATAGGACGTTCGTGGACGGATGGATGCTTGGTTGTGTGTT
TCTTGAGGCGGACACGTACCTGTGTGTCACTTGTCTGTATGTTGGACCTGCCAATtttcagcaagaagctggtggccGTGGCGGGATATTCACAGCTTGC
AGCTAGCGAGAACGAATGAAAGAGCGCGAGTGAGCTCAAGTACGACAACAATCAGCGTGGACTTTGCAAACAATTGTGGTCTTAGATATCATCACTGGTC
AGACGTCGACGAGTTCCGAGACTCTACACCATACGCGGCGTAGGGGATCTGTTCTTCGCCAGCGGCAactcctcgtccgagtctTCGGAGGCGTAGTAAG
CCCTGTCGCGCTTGATCGTGAACGTGTCCGAAAGGAAGTCCGACTCACCCGCACGCAGTTTTTCTTTCCGCCACATCGTGTAGCACACACCCATCGCGAC
TGCATACAACATGGCTGAGCAGCATCACACCAGGAAAAAATCACCccgcgcagcagccaccagcaccaaacAATACACAGAGGCAGCCATAAATTCACAC
ACGAATTAGCATTCCTACACCTTGCACAGCAAAACAAATGTAGCCACTTCGAGCTCATATGGCGGACGCACCGGCTTCAAAGCACGAGTTGGCCCCGGAA
TTGGGCGTCTTGGCGTTGAGAATGTACATTGGCTGCAGCTTTAGCAACGaccccaccaccacctgtAATAGCCAGCATTATAAAGAGTTGAACAAGTGTT
AGCAACGGTAAATAATTGTAGCAGAGCGCTCTGCGACCACCGAAAGCGTCACATAccaggaagacgaagccgacgaagcagaaaatGGTGCCACACAAGT
AACCTGCAGACAGCGAAACGGGTATCAACAGGCAGATTAGACACAGGTGAACCAACTGGGAAGCGAAAAGTATGGGGAATAGCTGTCCTAGGCGACACGT
ACCCCCTCCGCCCATGCTGCTGTCTAATGCCGATGTGCCTTGTTCCTTGCTCTTATGAATTGTCAATCCAGCTGCTACGCCCCTCGGAATATTAGCCAAT
AAAAAATTAGATGGGTGGATTCGCGGCTCTGAACCATTCCGATGTACAGCACACCATTTCAGtggcagttgaagttgtttaCGCATCAAATGACATGCGA
AATCGGCGACTCAGTCTCAGATTTCTGTGCTCACGCTGCCGCCATGGGTGTagccaagaagctgcgtgTGTTGTGCATGCACGGGTACCGCACCAATGCG
AAGATCATGGAGGACCAGACGCGTGGGCTGCGCATGGCACTGGCTCCACACGCTGAGTTTGTGTTCCTGAACGGACCCATCCAAGCCCGCGGACCTTCGG
ACGACGTCATCGAGAAACTCTACGCCGAGCACAAGCCGTCCTACGAGTGGggcagcttcatcgagcgCGAGCGGCCGCACAGACTTGACCCTGAGACGCA
GGAGATCGAGTACTTGGACAACGGATGGTACCATGACTACGTGGACTGGGACTCCACGGTCAAGTACATGGATGAACAGTTACCCAAGCTCGGGCccatc
gacgctgtcgtGGGATTTTCTCAGGGTGCGCAAACGATGACGGCGCTGACGATGTGGTACTtgcaccaccacaacaagCGCTGGTGGAAGTGTTGCGTGA
GTGTATGCGGGCCTCGAGTGCGTGGGGCTGCGCTCCGTTCGCTGTTCGAGAAGCCGGATGGGAATCCGCGGTTGGTGCCAATGCCGTCGATCCACATTGT
TGGCAAAACGGACAAGTGGCGTAGCGGCTGCTACGAAATGGTGGACATGTACGAGGACCACCCCGAGGACGCAGCACGCGATAAGTTCGTGTTTGAACAC
GACACAGGTCATCGCTTCCCGTCCGGAGAGAGACACGATCAGCTCTACGAAGATGTGGCCCGGATCATCCAGCTGCATTGCAAGTGAATTAGCAGCAGTA
GATCCGACAAATGAATGTGGCTGTGTGTTTGTTTGTGTCCGCtgcacatacatgtaccggtaacgAGCCTCATGGAGCATGCGATGTTCGTGCGATTCAA
CCCGTGCGCTTTATAAAGATGTTGAAGATACTGTAGTGGTCGCTCATCACCCATCGATTGTATTACAGTAGTGGCACGCGCTGTTTGAAAACGCAAGATT
CACGTCCCCATATTTTCACATCCTAATTTGCTGGTGAGGTGGTAGATCACGCTCTTGTCCATGACAACCGCGACGAACAAACTTCGTATCCTGTCACAGG
CCCAGTGACACAGGATTCCTGTGACTGCACGGATACCGCACCAATGCGAAAGTGATGCAAGATCAGACGCGGGCTCTGCGTCCTGCCATGGCTCCCCACG
CGGAATTTGTGTTTGCTACAGCACCCGTTCGAGGCACGTGGTCCTTCTAACGAGGTGATCGAGCGGCTTTACCAAGACCATGCGCCGTTTTACGAATGAG
GACACGTTACCACGCTCTATCGCCAGCCTGACGGCAGCGACAACGGATGGTCCTTTGGATGGTATCACCAGTACGTCGGGTTCGACCGGGTCGTGGAGCA
CATTGACAAACAACTTCAAGAGTATGGTCCCTTCGACGCCGCCATCGGGTTTTCGCAGGGTGGGCAAATACTCACTGCCTTGTCGATGTGGTACCTGCAC
CAGCGCAACAAGCGCCACTGGAAGTGCTGCCTCATTTGCCCGGGCATCCGAGTGCAAGATATAGGCTTGCGTCCACTTTTTTTTTCGAGCACCCAGGTGG
CTCGCCCAAGCGCGTGCCAATTCCTTCCATCCACCTCATTGGCCTTACTACTGCACCTGCCGAGAGCACGCTGAGCTGTACGCCGACAACCCTCCAGGCT
CAACTTTGAGCAAGTTCGTGTTCGAACATGAAAGCGGCCATCGATTCCCGTCTGGGGAGCGCCACCCTGTGCTCTACGAGAAACTTGCCGATATGATTCG
ACTGCACTGCGGTCAGGCGAGCAAC