Description :
From Genome Similarity Track
Location :
Scaffold_537:2293- 4396
Transcript NameFunction/comments
Physo_145150reverse transcriptase

Sequence
2103 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGTAACAGCGCCAGCACTTGTTTCTCCACCACATCGTAATTCAGTTCATTCGACTTCAGCGTTCG
ACTGGCGAAAGTAACGGGATGATAGATCTGGTCGTGCTCCTGCATCAATGCGGCAAAGATCGCCCAGTCACTGGCATACACAATCACGACCGGAGTCCGA
TCGCGATCGAAGTGCCGCAGGATCGGTGTCGTCGCGATCTTCATCTTCAGGGTCGAAAAGGCACGATGAGCACGGATCCAGCGTTCATCGGCTACACCGA
CTTCAGGAACTGATGGAGTCCGATCGGGGATCACTGGGTCCGTATCCACTAAGTTCGGTACTTGACGATCCAGGATCTGGCGCAGATCGGGGCGTTTCTT
CAGCTCGGCGAAGTCCACCTCGCGCAGTTCGTACAGGATCGCTGCGTAGATCGCGTAATCTTCCAAGAAACGGCTGTAATAATTGAGACTGCCCAAGAAC
GACTGCATCGATCGGAGTGATCCGGGGAACGGCAGATCAGTCAGAGCCGTGAGATCCTTCGGATTGGCCTCTAGCCCGTCGTTCGACACCCGATGTCCCA
GATAGTCCACCTTACGCATCCCCCAAGAGCTCTTCTCCACACTGATCGAGAGGTTCCACTTATCACAAGCGTCCAGCAGGTGATCCACGCGATCACACAG
CTCGTCCCATGACCCGGCCGTCACCAAAATGTCGTCAATGTACGATCTGCGACCTAGCACTGATGGACGCCCCGGATCTTCTGGTTCTCCTGACTCGATC
AAGTCCGTAGTGACTTCACAGTCCGACGATCGCGGGATCCTGGTGAACCCATACAACGCGTCGTCCAGAAGTCGCTGGTAGATCTGAGGAGCGTTCTTCA
AGCCGAACGGCATCCGGTTCCACTCGAACAGACCCATGTGGGTGATAAAGGCCGAGATCGCACGAGCTCGATCGGTCATTGTCACCACCCAGAATCCACT
AGCCATGTCCAAAGAGCAATACCAGAGTACCTTATCCAGATCCTCCAGCAAATCGTTGATCAAGGGCATCGGATATACCATCAGCCTGGTTAGACTGTTG
ACGAGCCGATAATCGATGCAGAGTCGGATATCCACGCCGTTCTTCTTGATGATCACGACAATCGGCGAGGCCCACGGTGATCGAGATTTCCGAATCATCT
TGGCTGACAATAATCCCTTGATCAGCTCGGACACCTTCTCCACGAACTGAGGGGCAACTTTCCGGACACGTTGAGCGATCGGCTTCGCGTCGCCCACGTC
GATGTCGCAGGTGACGCCCCGGGCTGCTGGGGGAAGTGCATTGCCCTTGCCGATCAGCAGGTGATTCCTGTGCCAGATCTTCTTTCGCAGCCGATCGATC
TCCTCCGGGGTGTTGAACTCCAGATCTCCCACCTTGATATCATCGATCTTCACCTCATCCGTCGTCAGATCACAATTTCAGGAAGCACAGCTAATTCACC
TTGGACATCTTCTGCTGACAGATTCCCGCCCTCGTGGTAATGGACCTGATCATCAGCACCAACGTCTCGATCTGGTTCGGATGCAATGAGGTCGTCCCGA
TTT