Description :
From Genome Similarity Track
Location :
Scaffold_2:2292965- 2300239
Transcript NameFunction/comments
Phyin_T30-4PITG_01508Putative uncharacterized protein
Phyin_T30-4PITG_01509Putative uncharacterized protein
Phyin_T30-4PITG_01510Putative uncharacterized protein

Sequence
7274 bases(100 bases per row)
CCCTGTTTGTTCCTATCCAGTGTGTCCCTAACACCAACTAGCTCACTCACTAGCTCGCCGCTCACTGCATCACTTGGCCCCCCACCGAGTAGTTCAGCAG
CAACGGATCAATCTTTTGGCCCTTCGAGCGGCGTTTACCCCGCTTGTTCGATGATCCCGTCTCGGATGCACGCTGCTGGGCGTCCTGGTTACCTGTCGAT
TTTTTGCCGCTATGTTGAGTCTTCTTACGTTGGATGAACTCCGTGGCAAAGGCTGACACACGGGGCGTGGAGCCCAAATACGCAGCAAGATACTCGCGGA
CCTCACCAGGGTCCTCTAGCGTGGCGCAGTATTCCAACAGCGTCACATCGGCGTTGCTGTCAATTGCTTTCAGATGTCTCAGGGCCCACGTCATAAACTC
CGACGACACATTATTTGAGCCGAAAGCATTTGAGGTGCCCACCTGAGCACCGCTAGTTGCAGACTCCCTCTGTGCTGCTCCAAAGTTCCAGAACGACGCA
TCGCTATCAGCCTTGGGCGGGGAATGTTTCACAGCGGCTCCATTGGTAGCACGGATTTGCTGACGACTTTTTATTACTGACGCGGGAACAGGGCCCAATG
CTGACCGTGACGGCTTGGGGATGGCTGCTGCAGCAACATTGTTGCCTGCCACGATATTCATCCAGTGCGAGCTGGTCGGTGCATACTCATTGACCTTAGC
ACGCTCCTGCGCCAGACGCTCCTCTTCAGCCAAAATGTCACGCATAGACTTGGAGGTGCTGCTTTTTGTCACAGTGGCAGGTGTTCCCCACGGAGCTGAG
GGCGCTGCTGGAGCAGTAGCTGGTATCGTTTCTGGTGCGGCCTTGGCTGTCGGAGCCTGAGAAGGGCGCAAAGGAGCGCTCGGGGCCACAGCCGTGGACT
CCACGCCCAGCATCATCTTTAGCTGTTCTCCCATTTGTGCTAGGTTCGCATTGCCACCCTTCTCAGCACTCATCTTCTTGAGCAATACACGCTGTTCCTC
CTGTTGAATATCCTTAAGCGACTTGGACGACGGCGCTTTTGTAGCCCACGCATTTGTCTCAGTCTGGACATTCTTGCCATTATTTATTGACTGACTAGTC
TCCGTCTCCTTCTCAGCCTTTCGTTCCCTCTGGGTGGGTTTGATAGGAGATGCAGCATTGAATCTTTCTTGTAGACTGCGAATCTGGTCATCACTGTTGC
GAGCTTCCTGAGCAACACTCCGCTTCTCCTCGTTCTGAATGTCGAAAAGAGTTGGTGATGGACGCTCCGGGGACTTTGGTCTAGTTCCCCACGCATCAAC
CACAGGGGCAGCAGCTGGGCTTGTCGGTGCAGGAGGCTCGGTAGATTTCGGTGCCGCTGGACTCGACGGGCGTGCTGATTGCAAGTCACCCGCTGTGTTC
GCAGGTACAAATCCAGCCATTTCCGGAGCTGCATTCGGCCAAAATGCCTCCTCACGCCTCTGCACTTCATTATTTAAGAACGTCGAGCGTTGAGGTTGAG
TAGCCTGCATCTTCAGCTCGAGCTGCGTGCGGTAGTCGGACTGGAACTGAATCTGCATACCGTCCGATCTGAAATTGTCGTTTGCTCCCACGTTGGGGGC
TTCTTGGTTTCCTCCAAATATGCCTAATGCGCTCATAATACCTTCACGCTGGCTACGCTGCCACGAGCTTTGCTGTTGCTGTTGCAGTAGCATTTGCTGC
TGTCGCTGCTGCTCTTGCTGATGTTGCAGCATCGGTTGTTGCTGAAACAATTGTGTTTGCTGCTGTTGCCGAGCGATTTCAAGACATTGCATCTCAATAC
GAATATTCTCTTTTTGGTCCAGGTGCATCATTCGCTGCTGTTGTTGTTGTCGCTGAAGCTCCATCATTTGTTGTTGTTGTTGCTGCTGTTGACGCTGTTG
CTCACGTTGCAGTTCCAATAGGCGCTGCTGCTCGTCCTGGCGAGGGTCCACAAGCATTCCTCCCAGTTCGCTCATACGCGTTGGTGGGGCAGCGAACGCC
ATTTGTCCGTGCACGAATTGATTCGCCAAGGGCGTAAAAATTCCTTCACGCCCGAAACGAATCGGTAGATGCGGCTTGAAGTAACCAGCCTCGAACCATT
CCCGCATCTCTGCTGTTTTAAACGGACCCTGTTGTAATCCCTGCGGGTCCAAGTAAAACCATTCGTCCTCCAATTCCAGTCGTAGCGATGATAACCCACC
AAAACCTTCGTTAGCCGGCATTGGAGATTGCGAGAAGCTACTTTTCTCTTCAAGTACCAGTTGTTCACCAGCACGCTCCAGCGGATCGAACAAGTGGCTG
CGACTAGACTGACGACCCAGCAGATTCGCCGTGCGATCTTCCAATGGGTCATTACTAGTGCTAGCCTGAAGCTGCTCTTCGGGAGTAGGATCATCCCATT
GTACTTCGTCGTTATCACTATCGTCAAATTGCCCTGCAGCAGCAGCATCTTCTAGTTTCTTGTCAAAAGCATCCAAATCGTCCTTTATCGCGTCCTAATA
AACAACACATCATCAGTTATCCGTGTCTACCAGGTTTGTGCAGCTGTATTTAGCCTTACCGAGTCGATCTTCGATCCCTGAAGCTCCTCTCGCATCGCAT
CCATCTCTCGTCGGAACTTCTCCGCCGCGAGTGCCATACTTGACAGATCCTGTATTACATATACCAAAAACATCAGTTAGTCGTCTAGATATCACCATTT
CGCTGCACAAGTCGCTACCATTTCATTGCTTTCCGCGCCAGGCTCTAAAACATCATCCCATACATCGTCTCCATGCGATCCCTCTGTGATCTTGGCGCCA
CGTTCCCACCTTGAGTCTCTCTCGTTGTGTCGCTGCTGTTCGTCTCTCTGCTGCTTTGCTTCCTCTCCGTCGTTCCCACGAAATCCTCGTTCCTGTTGCC
CACGCGTTCCCTGTTGACCTCCAGGCGGTGCGTTGCCTCGACCGCGTCCACGTCCACGATTGCGGTTGAGCGACCACTGCTTGTAAATCTCCTCGTAGTC
GAATGGCAGCGTGCTGACGGGAGGAAGACTGTGCTCCGAAGCCACTGTGGTCTCGGGGGGGAAATTGGGTGCTTCAGTGGTTGTAAAATGCAGCGCCAGT
AGATCTTCCTTGGTGTAGCGTAGCACTTTAGTCTTGCGACGCTCTCCCCGGTGGTCGTCGCCCTGTCCGCCTCCTGTGGCCGCTTCTTTGAAGGATGCCG
GGCCGCCCGAGGACGCTGATACGAAGCCTTCACCGTCCTTCGACCATTGCGGACGATATGCGGATCCCTCTGAATCGGTACGCCCACGGCCCTTCATGGC
GAACATTGTACGCGGCCGCAGCGAGATGTTACTACTGCTAGTGCTGGCGCCGTTGTTGGCCGTGGGTGGTTTCTTGCTAACCACATCACTAGGAGCAGCA
GACTGCTGCTGTTTCTTGCGGTGCTTGGTGGTTATGGTGACGAAGTCATCGTCATTACTGGGGCTACTGCTGCTCATGGCGGCGCCCGTCGAAAAGGTGC
TCGGTGGCTGTTGCTCTTGCTGTTGGTTCTTTGGGTGTGGGGGGAGGAGTGCTGTGGGGTTTCGATTAGATACGAATTTTGCAGAAATTTTTTGATCCCG
TTTGACAGTAAAGATGAGCTCTAGGAATCTACCTGAGCGTCTGGGGCTGCGCAACTGGCGGTGCGTAATCTGCATTTGTTGCCAGTGCTCATGTGCTGAC
CTATGTGTCGTTTTGCGTGTCTGGAATATCCATTCGTGATTCTTTTGCAGTGGCGAGATCATCCAGCCTGGAGCCGCAACAATTGCTTGTGATACAAACG
AAGACTCTTTGACTGGCCACGGATCTACGGAGACAGAACAAACCTCGCCTCCCTCGGATGACCGACATTCAGGGCAAAAGAAGGTGCTACGCAAAGATGA
GTTTGGCCGCGACCTGGAGGTTGTGGTCAATAAAACGCACCGCAAGAAATTCAAAGAAGCAGGAAGAGGAAACAGGAAAAGGGAACGGAAACACAAACAC
AAAGGAAAACACAAACACCACCGAGATGAGAACAGCGATAGATCGAGGTCAGCAAGCCCTTGTGGTCGTCTTATTGGCACTCCGCCACCAGCAGATCCGT
TTCGCCCACAGGTACGCTTGGTTGATGAGCGATAATTTGCGACGGGACAATGACTGTTTTATCATATGCATTCCGTATAGCTGGATCAAGATCGAGGCAG
ACATTCGCACCACCGCACGCATTATAGGAGTCGAAGTCGGAGCCACACTCGACGCAGCAAGAAGGGATCGCGCCGTCACAGTCGAAGTCGTGAAGATGTA
AAGCCACGAACCGATGACCACCGACGTCGCTCTCATCGGAGGTTCTTCCGGAGTCGTAGCAGAAGTCGAAGTCAAAATCGTAATCGAAGCCCGTCATCTC
TTCGGTCTCGTCGGAGATGCTCATCGGCCTCCAAGTGGACTCACAACGCCTTTAACGATCGCAGCCAGAGTCCACCCCGACTGGTCGATCCACTTTATCA
ACCGGAATCAGAGACCTGGGTTTCACGAGCAGGCGGTGTGTACTTACCCCGCATATAGAACCACTATTTCGGAGCGCGCCTGAAATTGTTACCAAATGAG
CACACTCCTCCATGACTGGGACGAAGGTGTGTTAGTACGATCTACTTCCCTTGGTCAGCTTGAAATGATACAATGACCATATTATTGGCTGCTTCCCTCA
TCCAAGTATCCACCTCATCATTTCTGTATTTGTCAGGCTCGAAAAGCAAACGCAAGAAGCTTCTGGAATGGTTTTGCAGCCATTTTGACGGTGGTAGACT
GCTCAAGAGCGAGTACGATGCCGATTTCGCACTCTTTCTGCCACGTCTTCTATCGTGGATGCAGAAAACAACTGCAAGCGCCATTTGCAGCTCTAACGAC
CACAGGGCCACAAGTAAGCCAGGAAAAACTAAGTGTCTTGCGCTTACGGAGCAAGTGGCTTCTCTTCATGTGTTCTTCGACTCCGCAAACGCGCACGAAT
ACTATCGAGAATTCCAGCATGCTAACGGTCTTCAGTTGGTGTTGAAAATTGTGGCGATTCACGGCAATGTTGCCCAATCTGAAAAACCTCTCGTGTCTGT
CACCGACCGAGAAACCCTCTTTCGCGTCATCCTGCGGATTTCGAAGATGAGTCGACAATGCAAGGAGGAAATCAGTCGTCTGGACGGCGAACTGGCTGTG
ATTCAAGGGGTTCTAGCTAGTGGCGAGATTGGTGATTGGAAAGCGGAGTCTCGTGTGTGGACGCTTTGTCGGGCGATCCTTCTTGAGCAGCTCGTAGGCA
ACCCCAACAGTCTCGATCAATCTCACGAGGCAATTGTATTCATGCTAAAGCACTTCGAAGTGCGTCTTCAACTCTTTGGAGCACAGGTCGATTGGCGTCG
TGTTGAGCTTCTTTGGCTTTATCGAACTAACCGTGAACGTTACTCCAGATTCTCCACGAGTTAATCTCCAAAAGTTCATTTTCCTTTGACCCTGAGTATC
GAAGGCGGAAAGAGAATGATCTTGTGCCTCTTTGCCTCGCCCTCCTCGATTCGAGCGACGTCTACCTTCAGCATAAGAGCCTCGAGCTTCTGCACGATCT
GCTGCAGTCGAAACACCTACAGGTTTGTTTGTCCATCGGTGTACTTTTGGCTTGTTAATAAATTTACTGTATGACAGGGTATCATTTGTGAGAAGTTCAC
TCGTCTGGTTGGCTACAGTGCCAAGGCATTAGATGCGTATGCGTCTCTGCTTGTGAATGGATGGTCATTTCCTATATTTGCTCACGGTTGTGTCTCTGGA
TGTCGCTTCACTTCCAGCAATGTTGAGGAGCGATTCGCATTAATCGAAGATACCACGGAGCACGAGACCTATGCTCATCTCAGATCTGTTTTTACCTCAG
CATCCCAAGCCGTCAACATTTTAATGAACTCGAATCGTAACCTGTTGCCGATCTTGGTTTGTCAAACACTTCATAACACGTATAAGGTATCTGCTTGGGA
TTAACTGCACCTACGTGAGCAGGTCGATCGATGTGACCTTCTGACTCCTCTGGCATTCGTGCTCGTTGTTGAACGACCTCTCTCATTGAAATGGCACGCG
GCTGCAACTACTATCCAGTTCATTATCTTGCACCATTACCAGGTACTATATGTAGTCCCTCTTCATAATCGTAGTATACCAACACATACGCAATCGATGA
CAAAGTGTGTTGAACGGTGTAGGGAGCTGCCGCACGACTCAGTGAGCTATTCGAGATTTCATTAGATGAGCTAATCGAATGGAAAGACAAACGAGAAGAT
GATGGCACGATGCTCGCTATGTTTCTACTACGCGACGAGGCTCATCGAAGCCACCTTGCTCTCCGATTTTATCAGCGCCGATGGTATCGTCCGCTGTCCC
CAAGAAAACTACACGTATCCGAACAGGTCGATGCAGATCGCGTCCTCAACGACATCGATAAGTGTCGAGAGAGCTGCGCGACCACTATGTTAAGCGACAG
TGTGTCTGGCTCACAATCCGCCTAACGCACAATCTATCGATCTTCTGTATTACTTCGAAGTTGCTCCGAATCCAATTGCGAGTGGGCGGGGGACGCCGAT
GAGACCGAGGAAATTGAGATCCTGCAGAACCAGCGCAAGCATCAATTGCGTGTTCAGCTACAAAATCACTTCGCTCAGTTTCGTCACATATCAACATTCG
TAGCGACCACCACCAAAAATAAGCAATCTATGTGAAATTAATACCACGGGACTGACAACTTAGCCCAGCAAAGGTCTTTAGTTTTCCTCGGGCGTGTAAT
GGTCTTCCAGGAAGCGCGACAATGTATGAAGCTGCTCAGACACAACCTTGACCTTTTCGCGACAAATTTCCACATCCTTTTCTGCTCCGTAGGTGCTGCG
TGCAAATGTGCGGTAGTCTGAAACAAGGTGGATGTGGTTGGCCAACTCGATGTGGATCTCCTTGACCAGCTGTAGAAACTCAGTACACGCTGAATTAAAG
GCCAGCGATGAGCTCTCCTCGGACGACACACGTGGTGCCACGAGCGACATGGCAGTAGCCGCTGTATGCAAAGCCGTCACCAGTTTCTAGTGGCAACCAC
ATGGGTTTAGTCTCGAGGTGTGAGTCTTATATGTGCAGCTGGACGTCTGATTGCAGACATGCACGCACCTTCTCGACGGCGTCGAGCGCCTGCAGCACCG
CCACATGACGTGAGCTGGACCACGGGTCGCTCACCTCGGAGAAGTGCACACGACTATCTCCTTCACCTTCCATG