Description :
From Genome Similarity Track
Location :
Scaffold_299:22918- 25130
Sequence
2212 bases(100 bases per row)
TGGCCACTGAGCAATGTGGATCTTCGTACCCCTGAGCATTTTGAGTGTGAAACTTGTGTAAAAGGAAAAATTACTCGAAAATCCTTCAAGTCAATAGCGG
TCCAGCATCGAGAATGGTTAGTGGGCGAGATGACTCACCTTGATGTGTGGGGTCCATATGCAGAGCCGTCTTACGGTGGTAGGAAGTACTTTGCAGTCAT
TGTCGATGATGCAAGTCGGTTTGCTACTGTAGTCTTACTCGAACGTCGCTCGGATATTTATGATGAGTTTGATGCATATTACGAGCGCGTTAAGACCCAG
CTGCATGTTCGGATGAAAAGCTTGAGAAGTGACAATGCGAAAGAATTTGACAAGCTGCAGCAAAATTGCGCTCGGTACGGACTGGAGTGCACGACTAGTA
TTAAGCACACGCCGGAACAAAATGGAGTTGCTGAGAGGATGATTCGGACTCTAACCGAGCGGGTGAGATGCTTGCTGTCTCATTTCAACCTACCGCAGCC
GATGTGGGCGGAAGCTGTTATGACAGCAGCATACTGTGTGAATATAATGCCAAATTCCGTGCGAGGCATGGAGATTCCGTACACTGTCTGGTATCGTGAG
ACACCTTCCTATTCGAAGTTGAGGCCGTTTGGATGTGCAGCTCTCACATACATTGACAAAGTGGAACGACGAAAGTTGGATGCCAAAGCACGAGAGGCAA
TCTTTGTGGGTTATTCCAGAGAGAAACGTGGATACCGTTTCCTGGATAGTAAAACTCGCAAGGCGTTTTACAGTCACACCGCGGTCTTCTATGAAGAGAA
GCCAGGCAGGGTGATAGTAGGCACAGCAGATTCCGTCACACACGCTGCGTCCACGGGGGAATATTTTGGTCTGAACGACAGCACTGTGCGGGATCTGGAG
CCCATTCTAGATGAAATGCATGAAGAGGATGAAGCCAAAAAGCGTTGGGAGAACAAACGTCGAGATGGCGTGGCCACCGACGAAAAGACAGAAAAGTCTC
AAATTGGTGGGGCTGAGTTGTGTGATGAAAATAAGAGTGATGTTGCTTTGAGCAGCAGAAAGCGTGGTCGCATCCATGAGATGATGACAGATAAACCGCA
AAAGCGTGTAAGGTTTCATCGCAGTAAGCGGTGCCCGGCACCGGCTGCAGCTCTAGTGGAGCGTAGTCCTGAGGGACAAGAGGAGGATGCCACGGCCAAA
GTGCCAAAGTCTCACGTGGATGATGATGTGGAGCGCATAGCAGCGCATACACAGCAAAGTTCACTGGAGCAAGAGCCACTGGAAGATGGAGAAAGCAAGT
CCTATCCAGTAACACGGAGTGGACGAGTATCCAAACCTCCGCGATGGCTTAGTGACAGTGTGCATCTGGCCTATAAAGAGTCAACCAATGCTGATGACAC
TCGTGGACTGACAGTGGCCACAGGAACAGAGTGGAAGAAGGCTCGGGCCCAAATGCAGTTAGAGATTGCGAAAGAGAGGGCAATGGATGTGTGGCAAGTC
TTTGTTTGTCTTACTGCTAGTGCTATGTTTGAGCCGATTAGCTATAAGGAAGCCATGCAAAGTGATGAAGCCAAGCAGTGGAAAGATGCAATGGATGCCG
AGTACGAGGCCTTGCTGAAGAACGGCACCTGGAAGCTGGTGCGAAGAACCAAGGACATGAAGGTCCTGAACAACCGTTGGGTGTTTCGAGTGAAGTATCA
TGCAAACGGAGACATTGACAGGCCCAAGGCAAGGCTCGTCATCAAGGGCTTCATGCAGATTTATGGTATTGATTTCTTTGAAGTTTACTCGCCTGTGGTG
CGATTGAAAACTTTGCGCATCTTGCTCACGCTAGCATCCATTTGGGACTACGAGGTAGACCAGATGGACGTCTCCACTGCCTTCCTCAACGAAGGCATCG
ACGTGACGGTTTACATAGAGCAGCCCGAAGGCTATGAAGTGAAAGGAAAAGAGGATTTTGTGTGTGTTCTGTTGAAAAGCCTCTACGGCTTGAAGCAGGC
TCCTCGCGTATGGTTCAGATTGCTGAAGGATTTTCTAGAGAGCGAGGGCTACACACTAATGCAGTGTGAGGCATGCGTGGCAGTGAAGGCTGTCGACGGG
TGGCTGGTGCTCATCTCTATCTACGTTGACGACCTGATACTGTTTGCGCCGACAAAGGCCATGATGAACGTCATGAAGCAGATGCTTTTCAGACGCTTCG
TGATGAAAGCCT