Description :
From Genome Similarity Track
Location :
Scaffold_60:229103- 230844
Transcript NameFunction/comments
Physo_138105reverse transcriptase

Sequence
1741 bases(100 bases per row)
CCACACCGAGGAGCGCCGGAACACGCGGGTGTCGCCCGAAGTTGATGTCGAACGGGGTGAGCCCCGTTGACTCGTGTTCCGCATTGTTGATGGCAAAGTC
GACCATGGGCAGGAACGAGCTCCATGACTTGAAGGACGTGGGGAAGCCCCTCAACACGTCTTCGACGACCCTATTCGCACGTTCGGTCTGGCCATCTGTC
TCCGGGTGCGACGCGGTGGACATCGCCAACCGAGTTCCCACCAACTTGAACAACTCGGTCCAAAAGGCGGTGAAGCGGGGATCTCGATCCGACACGATTG
AGGTCGGAAGACCAGGATGGCGGTGGACGATGTCGAGGAAGATCACCGCAGAATGTTGTGTGGTGATGGTGGTAGCGTCAGGAGCAAGATGCACCATCTT
GCTGAGACGATCGACAAAAACGAGAACACCAGTGCGGCCTTGCCGGTCGCGAGGCAATCCAAAGGCAAAATCCATGCTCACCGAAGACCAGGGTTTGACC
GCCACAGGGAAAGGTCGAAACGGAGCCTGCTTCGTCGGAGATGGCTTACCACGCTGGACGCTTCGCAGGAGCGTACCCACTTCTGTACCCACTTGTACAT
ATGCGGCCAGTAGAAGTCTCGGGACAGCGACGCGAATGGCTTCTCGCGTCCGAGGTGGCCGCCGCTGGGCGTGTCGGGGAACTCGTGAATCAGTCGAGCT
CGAAAATCGTCGTCGAGCGGAACGACGATGCGCGGCGGGACCGCAGCTCTTAGCGATCGATCCGGGCGCGACTACGGGGAGATAAGTGGCGCCGCGCCGC
TGCTGATGGATCGCGTAGGTACTTGATTATTTCGGAGCGGGCTGGTCGCTGCGACGTCGACAGCAGCGACTTCTTCAGCCACACACACAGCACTCGTCGT
CATCCTCGTCGCCAACTGCGTGGCGACCCGACTGCACGTAGTCTGGCCGGCGCGAGAGCGCGTCAACAAAGATGTTGGTCTTGCCCGACTTGTAGTGTAC
GACGATGTTGTACTCGTAGAATAGCAAGAGCAAGCGAGCCATGCGCTGGGACAAGTGAGGGCTCTTCGTCGCTATCCGCAGAAACGCATGATCGGTGTAG
ACGGCGAAGGTCTGTTCACTCAACAAGAATACGCGGAACTTGATGAGTGCATAGCGCATGGCGAGCAGCTTTTTCTCGTGCACGGGGTAGTGCCGCTCCG
CTGGCTTCAGCTGACGCGACTGGTAGCTCACCACTCGTTCGCGTCCCTCATCATCAAACTGCACTAGGGCGCAGCCGATTGCGAAGGCGCGTGCGTCGCA
CACCACTTAGAAAGGCTTCGCGTGATCGGGCAGCATTAGGATGGGCGCGGTAGAGAAGCTCTTCTTCACCGCGTCAAAGGCGAGCTGATGCTAGGGACGC
CACGTCCACGTGGTGTCTGTCTTAAGGAGCTGGGACAGCGGACGAATGGTCGAAGCGAAGACTTCAAGTAGTGGTGGAGATACGTCGCGAGCCCCAGCCA
CTGTCGGAGCTGATTCTGATCCCGCGGCGTGGGCCACACGCAGATAACGTCGATCTTCTAGGGGTCAGCTCGGACACCTTCCGCGCTGTCGTATCTCCCG
AGCACAGGGATCTTGGGAGCGCAGAAGATGCACTTCTTCAAGTTAGCGTACAACTTGTTCTCCCTCATCCCCGCGCACACCTTCCGCAGGTGTTGTAGGT
GTATCTTGACGTCTGTCATGTCGCCCTCGGCACGGCTGTGA