Description :
From Genome Similarity Track
Location :
Scaffold_57:229081- 230790
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16447hypothetical protein

Sequence
1709 bases(100 bases per row)
CGTGTGTGCGTCGTAATCTGGGACGAAGTCTACCAGCATGTGGGATGAGGCAACCATGAATCTTCATCACTAACGGTCGTAGACGCCGTATTTCCGTATT
TCAGCTAGATTAGAGATCTGCTCCGGCCAATCGGGGTAATAGAGGCCATCGAAGACGTCATTCGACAAACTGCTTCAGACATCACAACTGGGCATGACAG
GAAGCAGACTCTCGGAGAGTCCATTTCCAGCGATATCGCTGTCGTCTGCGGATAAAAATGAGCTACAAGGTGTTGTGAAGACCATCCTGGACGCAAATTT
CGACAGATATTTACATTTCAGTGACGTGGATTCAAACGCGTGGAAGCTAACCAAAGACAAGGATGGAATGCAAGTCTACAGCAACCGACCAAGACGGCAA
CATCCTCATACTATTCAGTTGGACGAATTGCAGTCACTACTATGCGTAGGATCAGTTCCTGGTACTCTGGACGATATGATGCACAGCGTTCAAGAGGCAG
CTATTGGTGTCATGGACCCCAGTATAAACGACGCCAACGATACGGTACTACTACGGATCAAAGCAGCAACTGCACTCGATCCATTCGCAACTGTCGTGGT
TAAATGGATGGAGTTGGATGTACGCCGTCGATCCATGGGGTTTATCCAAAATCGAGACTACGTTTACGTCGAAGCGACTGGTATCAAATACCTACCAAGT
GGTGAACCTATGGGGTATCATGTCATGCACTCTGTGGGCATCCCTCAAGCTCATAACCTACCCGGACGAGTGCGTTCTGAGCTCTCCACATGCTCCTTCT
TCCTCCAAAAGAACAACACGTTGTCAGTCTACTCAATGGCGATACTGGAGCCCATGAGCGATCGTGTTCGACAATTCGTCGTTCCTCGCTTCCTCAAAAT
ATTGCAGTCAACGTTTAAGCCAATTTCAGTAGGCAAAGTGAAGAAGTTTGCTCAAACTATGGGCAAACGCTACTCCGAACTGGACAAGCGAAGACCGTTA
CATTCGGATCAAAAATGCGTCACGTGCACCAAACGCGTAGGACGTTTGGCAAAGCTCGCGAGTCGCCATAACTCTTGTATGGTTTGCAGTGGATCCATTT
GCACCGCGTGCAAGATCGAAAAGAAGCAGAAGCTTGTATCTTCGGACCTTAAAGTGAGCACCAAGAAGGTAGCTTTTTGCTTCTCGTGTCTAACCGACGT
GATGACTTCAAACGACTCGCAATTCTCGTTTGCAGAGGATTCTGACGGGGATATGGAGCTTCATCGACCGGTATATCATTCGGTTTGGTCTTCAAGATTA
CCAAGTTGGAGTAGCACAAAGACTAGCGAGTCATCGATCGATTTTTCGAGTACCAGGTAACGACTAAAGAAATCCTGAGGTTAGCCTTGGCCAGAAACGA
TGCTGAGGGCTGTTTGAGATAAGAATTTAAAGAGTGGCGCTAGCTTGTGATGCAGATTCTTAAGATTGATACCAGATGAATTTGATGTATTAAATACTAC
TAGTAGTATATGCTTTGTTTTTCTTTTAAACGCGTAAAGCACAGTGATACCAGTCTCGCAGGTGATATGGATGAATAAGTTAGTTTATAGGACCACGGTT
GAATTCTCGATCGGATAATTTGCCAATTATTATCTCCTAGTAACTAAATTCAGCCAATCACAGTTTATACTAATCGTATTTGAGCCAATAGCACAGTGTA
GGTCTAGGT